Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18120
Trapped Gene
Rab13 (ENSMUSG00000027935)
Vector Insertion
Chr 3: 90026220 - 90027448
Public Clones not available
Private Clones OST429784 (lexicon) OST355433 (lexicon) OST292437 (lexicon) OST290032 (lexicon)
OST283271 (lexicon) OST267329 (lexicon) OST257994 (lexicon) OST170936 (lexicon)
OST119505 (lexicon) OST116350 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000305414 (Chr3:90026159..90026219 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000305414 (Chr3:90026159..90026219 +)
Downstram Exon
ENSMUSE00000174453 (Chr3:90027449..90027509 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50 CTCCACGGTAATAGGCGGTA Chr3:90027507..90027526 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672921 Chr3:90017617..90017744 AAGGTCCGTAAAGGCTCCTC Chr3:90017703..90017722 59.71 55
upstream ENSMUSE00000566764 Chr3:90024739..90024944 TGTCTGATCATTCGCTTTGC Chr3:90024887..90024906 59.96 45
upstream ENSMUSE00000305414 Chr3:90026159..90026219 ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50
upstream ENSMUSE00000672920 Chr3:90026159..90026219 ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50

*** Putative Vector Insertion (Chr 3: 90026220 - 90027448) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174453 Chr3:90027449..90027509 CTCCACGGTAATAGGCGGTA Chr3:90027507..90027526 59.97 55
downstream ENSMUSE00000672919 Chr3:90027449..90027509 CTCCACGGTAATAGGCGGTA Chr3:90027507..90027526 59.97 55
downstream ENSMUSE00000174454 Chr3:90027712..90027789 No primer for this exon
downstream ENSMUSE00000174448 Chr3:90028416..90028505 GTCACACTTGTTTCCCAGCA Chr3:90028466..90028485 59.73 50
downstream ENSMUSE00000174450 Chr3:90028624..90028689 ACTGGATTTGGCACTCGTCT Chr3:90028677..90028696 59.73 50
downstream ENSMUSE00000174451 Chr3:90028770..90028823 No primer for this exon
downstream ENSMUSE00000456693 Chr3:90029431..90029885 GCTTGAGGGCTTACTGTTGG Chr3:90029457..90029476 59.88 55
downstream ENSMUSE00000672918 Chr3:90029431..90030307 ACAGGATGTCCGTCCTTCAG Chr3:90030068..90030087 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTGGACATAGAGGGGAAGA Chr3:90026182..90026202 60.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTGGACATAGAGGGGAAGA Chr3:90026182..90026202 60.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027935