Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18131
Trapped Gene
Plac9 (ENSMUSG00000072681)
Vector Insertion
Chr 14: 26708506 - 26710246
Public Clones not available
Private Clones OST429487 (lexicon) OST256080 (lexicon) OST219321 (lexicon) OST208667 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650466 (Chr14:26710247..26710341 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCAAAGGCGGTTAGACAT Chr14:26710257..26710276 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650466 (Chr14:26710247..26710341 -)
Downstram Exon
ENSMUSE00000650465 (Chr14:26708382..26708505 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCAAAGGCGGTTAGACAT Chr14:26710257..26710276 60.14 50 GGGAAGGTTTGAAGCCAGTT Chr14:26708400..26708419 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650467 Chr14:26722272..26722368 No primer for this exon
upstream ENSMUSE00000650466 Chr14:26710247..26710341 GTGCAAAGGCGGTTAGACAT Chr14:26710257..26710276 60.14 50

*** Putative Vector Insertion (Chr 14: 26708506 - 26710246) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650465 Chr14:26708382..26708505 GGGAAGGTTTGAAGCCAGTT Chr14:26708400..26708419 60.48 50
downstream ENSMUSE00000691363 Chr14:26706998..26708012 GTCTGGCGAAAGCCTGATAC Chr14:26707094..26707113 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr14:26710176..26710196 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAAAGGCGGTTAGACATT Chr14:26710254..26710274 60.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072681