Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18137
Trapped Gene
Zcchc7 (ENSMUSG00000035649)
Vector Insertion
Chr 4: 44774721 - 44775347
Public Clones not available
Private Clones OST429445 (lexicon) OST385950 (lexicon) OST304886 (lexicon) OST245541 (lexicon)
OST224397 (lexicon) OST135268 (lexicon) OST133287 (lexicon) OST116905 (lexicon)
OST116347 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000412283 (Chr4:44774722..44775346 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGAAGTCCAAGCGGAAGA Chr4:44775064..44775083 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000412283 (Chr4:44774722..44775346 +)
Downstram Exon
ENSMUSE00000713624 (Chr4:44774722..44775346 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGAAGTCCAAGCGGAAGA Chr4:44775064..44775083 59.81 45 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418496 Chr4:44769440..44769564 CGGCTTCCTTACCTCATTTG Chr4:44769476..44769495 59.7 50

*** Putative Vector Insertion (Chr 4: 44774721 - 44775347) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412283 Chr4:44774722..44775346 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55
downstream ENSMUSE00000713624 Chr4:44774722..44775346 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55
downstream ENSMUSE00000418240 Chr4:44906405..44906442 No primer for this exon
downstream ENSMUSE00000286458 Chr4:44907788..44907913 TTGTGGTAAGGGGCAGTTTT Chr4:44907916..44907935 59.47 45
downstream ENSMUSE00000286450 Chr4:44908691..44908861 TCACATCGGTCACATCGTTT Chr4:44908842..44908861 59.97 45
downstream ENSMUSE00000527451 Chr4:44921323..44924931 TCGCCTAGTAAAAGGGCTGA Chr4:44923105..44923124 59.97 50
downstream ENSMUSE00000674536 Chr4:44921323..44921358 CGTTAGGTGATACTGCCTCCA Chr4:44921360..44921380 60.14 52.38
downstream ENSMUSE00000674532 Chr4:44937042..44938942 GCAGGCATAGGTGAGAGAGG Chr4:44938019..44938038 59.97 60
downstream ENSMUSE00000674534 Chr4:44938847..44938942 TTGTCCAGAAGGGGTCTTTG Chr4:44938894..44938913 60.08 50
downstream ENSMUSE00000286404 Chr4:44941990..44942107 TTCGCTTTATTCTCCGATCC Chr4:44942101..44942120 59.25 45
downstream ENSMUSE00000286396 Chr4:44943908..44945074 CAGAGACCACTCGGCTTAGG Chr4:44944349..44944368 60.01 60
downstream ENSMUSE00000674533 Chr4:44943908..44945087 CAGAGACCACTCGGCTTAGG Chr4:44944349..44944368 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAGTAATCGCCTTGCAGCAC Chr4:44774768..44774789 59.4 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATAATGTTTGGTGGCTATGA Chr4:44774742..44774764 59.72 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035649