Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1814
Trapped Gene
Lrrfip2 (ENSMUSG00000032497)
Vector Insertion
Chr 9: 111118483 - 111122185
Public Clones CA0133 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220177 (Chr9:111118433..111118482 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCTGGAGAAAAGGACGAG Chr9:111118451..111118470 60.51 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220177 (Chr9:111118433..111118482 +)
Downstram Exon
ENSMUSE00000220174 (Chr9:111122186..111122306 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCTGGAGAAAAGGACGAG Chr9:111118451..111118470 60.51 50 GCATCTCGATGAACTGCAAG Chr9:111122306..111122325 59.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633933 Chr9:111020639..111020893 CGAGGAGCCCTTCTTTTTGT Chr9:111020743..111020762 60.73 50
upstream ENSMUSE00000633932 Chr9:111022144..111022215 ATGTCATTGGGAAGGAGAGC Chr9:111022183..111022202 59.09 50
upstream ENSMUSE00000382391 Chr9:111043694..111043836 AGATGGGGACTCCTGGTTCT Chr9:111043745..111043764 59.93 55
upstream ENSMUSE00000220179 Chr9:111063807..111063893 TGGAACGACAGCAGAGAGAG Chr9:111063874..111063893 59.28 55
upstream ENSMUSE00000633921 Chr9:111063807..111063899 GGAACGACAGCAGAGAGAGG Chr9:111063875..111063894 60.13 60
upstream ENSMUSE00000633920 Chr9:111065361..111065405 TCATTCCTTTGACCGGAAAT Chr9:111065363..111065382 59.36 40
upstream ENSMUSE00000633919 Chr9:111069553..111069609 ACTCTCACCGGTCTGGTCAC Chr9:111069575..111069594 60.16 60
upstream ENSMUSE00000220175 Chr9:111069704..111069748 ATTGTCTCTTCGGAGCCTTG Chr9:111069718..111069737 59.43 50
upstream ENSMUSE00000633918 Chr9:111075585..111075626 CCATCAAGGACAGACCATCA Chr9:111075592..111075611 59.47 50
upstream ENSMUSE00000633917 Chr9:111078281..111078346 No primer for this exon
upstream ENSMUSE00000633916 Chr9:111079746..111079820 TGGCCTCTACTTTGACCAGA Chr9:111079748..111079767 58.44 50
upstream ENSMUSE00000633915 Chr9:111081548..111081601 GGACACCCAAGAGTCAGAGC Chr9:111081579..111081598 59.84 60
upstream ENSMUSE00000633914 Chr9:111081681..111081725 No primer for this exon
upstream ENSMUSE00000633913 Chr9:111082377..111082424 No primer for this exon
upstream ENSMUSE00000633912 Chr9:111082720..111082776 GCAAGTTCCTCCAGAAGCAG Chr9:111082750..111082769 60.13 55
upstream ENSMUSE00000633911 Chr9:111085323..111085391 TGTCTTCTGATCGTGCCAGT Chr9:111085351..111085370 59.42 50
upstream ENSMUSE00000633910 Chr9:111086694..111086783 TAGGGGAAGCGTTGTCTCTG Chr9:111086729..111086748 60.39 55
upstream ENSMUSE00000220186 Chr9:111091266..111091310 No primer for this exon
upstream ENSMUSE00000220180 Chr9:111092672..111092788 GAACTCATCCAGACGGGGTA Chr9:111092716..111092735 59.93 55
upstream ENSMUSE00000633909 Chr9:111095551..111095622 TGATGTAGAAGGGCGGTACA Chr9:111095580..111095599 59.15 50
upstream ENSMUSE00000529078 Chr9:111102169..111102339 AAGAAAGCCATGGTGTCCAA Chr9:111102199..111102218 60.49 45
upstream ENSMUSE00000302618 Chr9:111108259..111108351 GCTGCAGCATAAGATGGATG Chr9:111108291..111108310 59.4 50
upstream ENSMUSE00000633907 Chr9:111110301..111110393 CAAGAGACCCTGCTCTGGAA Chr9:111110358..111110377 60.52 55
upstream ENSMUSE00000633906 Chr9:111116317..111116418 TCAGGAATGAGCGAGATGTG Chr9:111116351..111116370 59.94 50
upstream ENSMUSE00000302583 Chr9:111116645..111116777 GCTGCTCAGGTCTTGGAGTC Chr9:111116738..111116757 60.14 60
upstream ENSMUSE00000220177 Chr9:111118433..111118482 TTGCTGGAGAAAAGGACGAG Chr9:111118451..111118470 60.51 50

*** Putative Vector Insertion (Chr 9: 111118483 - 111122185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220174 Chr9:111122186..111122306 GCATCTCGATGAACTGCAAG Chr9:111122306..111122325 59.55 50
downstream ENSMUSE00000220185 Chr9:111124662..111124741 No primer for this exon
downstream ENSMUSE00000220178 Chr9:111125770..111125874 TCTCGCTGTAGCTTCCTCCT Chr9:111125876..111125895 59.33 55
downstream ENSMUSE00000633929 Chr9:111126454..111127829 GAAGGCACTTGGGTTTTTGA Chr9:111126939..111126958 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTAATCGCCTTGCAGCAC Chr9:111121531..111121551 60.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCAAGTGGTTCGTGACTG Chr9:111121522..111121542 59.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032497