Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18141
Trapped Gene
Ndufc1 (ENSMUSG00000037152)
Vector Insertion
Chr 3: 51211335 - 51212066
Public Clones CMHD-GT_438C9-3 (cmhd)
Private Clones OST429356 (lexicon) OST426559 (lexicon) OST426547 (lexicon) OST331570 (lexicon)
OST316951 (lexicon) OST316920 (lexicon) OST316776 (lexicon) OST316739 (lexicon)
OST313927 (lexicon) OST313845 (lexicon) OST291677 (lexicon) OST273835 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000265671 (Chr3:51212067..51212170 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTGGTTGGCAGTTGGACT Chr3:51212101..51212120 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000265671 (Chr3:51212067..51212170 -)
Downstram Exon
ENSMUSE00000376548 (Chr3:51211258..51211334 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTGGTTGGCAGTTGGACT Chr3:51212101..51212120 59.62 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568267 Chr3:51212786..51212860 GTAGTGCTGCGCTCGTTTTC Chr3:51212821..51212840 61.11 55
upstream ENSMUSE00000265671 Chr3:51212067..51212170 AACTGGTTGGCAGTTGGACT Chr3:51212101..51212120 59.62 50

*** Putative Vector Insertion (Chr 3: 51211335 - 51212066) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000376548 Chr3:51211258..51211334 No primer for this exon
downstream ENSMUSE00000512971 Chr3:51209401..51209541 ATCCGTCACTGAGGGTGAAT Chr3:51209464..51209483 59.38 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGGTTTTCATGTGGATTTATG Chr3:51212064..51212086 59.7 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGTTTTCATGTGGATTTATG Chr3:51212064..51212086 59.7 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037152