Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18155
Trapped Gene
2610029I01Rik (ENSMUSG00000028251)
Vector Insertion
Chr 4: 21686941 - 21694196
Public Clones IST10325E4 (tigm) IST12614E1 (tigm) IST12440B8 (tigm) IST10325E4 (tigm)
IST11080A11 (tigm) IST12440B8 (tigm) IST11080A11 (tigm)
Private Clones OST428934 (lexicon) OST381807 (lexicon) OST131444 (lexicon) OST68506 (lexicon)
OST60864 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240815 (Chr4:21694197..21694344 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGAGCCCATTGTGATGCT Chr4:21694262..21694281 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240815 (Chr4:21694197..21694344 -)
Downstram Exon
ENSMUSE00000177609 (Chr4:21686770..21686940 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGAGCCCATTGTGATGCT Chr4:21694262..21694281 59.83 50 AACAAAATGCTTGGCTGCAT Chr4:21686880..21686899 60.65 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000240815 Chr4:21694197..21694344 AGAGAGCCCATTGTGATGCT Chr4:21694262..21694281 59.83 50

*** Putative Vector Insertion (Chr 4: 21686941 - 21694196) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000177609 Chr4:21686770..21686940 AACAAAATGCTTGGCTGCAT Chr4:21686880..21686899 60.65 40
downstream ENSMUSE00000177610 Chr4:21686517..21686676 CCAGACGGTCAGATTTGGAT Chr4:21686565..21686584 59.93 50
downstream ENSMUSE00000177612 Chr4:21684530..21685622 ACCGTGATGACACATGGCTA Chr4:21685013..21685032 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr4:21688126..21688146 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGAAAAGCGCTTGATTTC Chr4:21688153..21688173 58.58 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr4:21688275..21688295 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTAACCTGCAGAAGCGTGA Chr4:21688289..21688309 58.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028251