Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18157
Trapped Gene
1110037F02Rik (ENSMUSG00000040720)
Vector Insertion
Chr 4: 11455938 - 11457974
Public Clones IST11849G11 (tigm) IST14485C5 (tigm) IST14485C5 (tigm) IST11849G11 (tigm)
IST10690G9 (tigm) IST12984B6 (tigm) IST10830C9 (tigm) IST12590D12 (tigm)
IST10830C9 (tigm)
Private Clones OST428929 (lexicon) OST330483 (lexicon) OST37151 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243457 (Chr4:11455685..11455937 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAGTGCGTGGAGTATGT Chr4:11455887..11455906 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243457 (Chr4:11455685..11455937 +)
Downstram Exon
ENSMUSE00000243449 (Chr4:11457975..11458192 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAGTGCGTGGAGTATGT Chr4:11455887..11455906 59.93 55 TCCATAATCGTGCTCTGCAA Chr4:11458178..11458197 60.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357176 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60
upstream ENSMUSE00000721837 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60
upstream ENSMUSE00000411884 Chr4:11421911..11422026 GGGAGTACGAGCCCATAGTG Chr4:11421982..11422001 59.57 60
upstream ENSMUSE00000332299 Chr4:11425887..11425973 TAAGCAAACCAAGTGCTCCA Chr4:11425934..11425953 59.46 45
upstream ENSMUSE00000408877 Chr4:11428456..11428504 No primer for this exon
upstream ENSMUSE00000371066 Chr4:11432589..11432757 ACAGCCGACTTTGAAAAGGA Chr4:11432726..11432745 59.85 45
upstream ENSMUSE00000243600 Chr4:11434101..11434223 CGATGAGGACGACCCTATGT Chr4:11434195..11434214 59.95 55
upstream ENSMUSE00000345092 Chr4:11435054..11435326 GAAGAGGAACCGCAAGAAGA Chr4:11435167..11435186 59.55 50
upstream ENSMUSE00000409119 Chr4:11440175..11441315 GCTGGGACCAAGCTAGTGAC Chr4:11440666..11440685 59.87 60
upstream ENSMUSE00000391429 Chr4:11443976..11444125 CACAGCCATCAGCTACTCCA Chr4:11444013..11444032 60.01 55
upstream ENSMUSE00000406656 Chr4:11446073..11446561 CAAGCCACGAAGGATGTTTT Chr4:11446155..11446174 60.11 45
upstream ENSMUSE00000243482 Chr4:11448252..11448406 TTAGAACAGCACGCAGCATC Chr4:11448340..11448359 60.17 50
upstream ENSMUSE00000348692 Chr4:11450000..11450082 GCAAATGGCTTGAACCTCTG Chr4:11450006..11450025 60.78 50
upstream ENSMUSE00000676263 Chr4:11453494..11453587 TGGCCTTACCACTGCCTTAC Chr4:11453526..11453545 60.13 55
upstream ENSMUSE00000386237 Chr4:11453742..11454286 AAGCTCACGATCTCGGAAGA Chr4:11454128..11454147 60.1 50
upstream ENSMUSE00000633428 Chr4:11453742..11454768 TGAAGCGAGTTGGAAGTGTG Chr4:11454423..11454442 60.03 50
upstream ENSMUSE00000243465 Chr4:11454795..11455030 TTGCCTCTCCAACTGCTCTT Chr4:11454964..11454983 60.13 50
upstream ENSMUSE00000243457 Chr4:11455685..11455937 CAGCAGTGCGTGGAGTATGT Chr4:11455887..11455906 59.93 55

*** Putative Vector Insertion (Chr 4: 11455938 - 11457974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000243449 Chr4:11457975..11458192 TCCATAATCGTGCTCTGCAA Chr4:11458178..11458197 60.37 45
downstream ENSMUSE00000243445 Chr4:11461336..11461468 ACCACTCGCTTCAGCAAACT Chr4:11461389..11461408 60.06 50
downstream ENSMUSE00000397336 Chr4:11467057..11467209 GCAGCGTTAAGACTCATCGTC Chr4:11467135..11467155 60.04 52.38
downstream ENSMUSE00000243434 Chr4:11467628..11467788 CTCACCAGATGACTCCAGCA Chr4:11467714..11467733 59.98 55
downstream ENSMUSE00000243429 Chr4:11469254..11469350 TCCATGACATCAGCCAACAC Chr4:11469286..11469305 60.54 50
downstream ENSMUSE00000349590 Chr4:11471978..11472144 TGCTTATGCTTCCCGAGTTT Chr4:11472126..11472145 59.85 45
downstream ENSMUSE00000177290 Chr4:11473116..11473447 GAAAATCCACCACGAGAGGA Chr4:11473382..11473401 60.05 50
downstream ENSMUSE00000177289 Chr4:11475878..11476021 CAACTCGAGCCTCTTGTTCC Chr4:11475920..11475939 59.99 55
downstream ENSMUSE00000605433 Chr4:11476692..11478290 TGAGGAAACAGCGACATCTG Chr4:11477508..11477527 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000040720