Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18165
Trapped Gene
Vps54 (ENSMUSG00000020128)
Vector Insertion
Chr 11: 21139375 - 21163201
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(ggtc) E326F07 (ggtc) D058G11 (ggtc) 3SE311C07 (ggtc) (ggtc)
D155E04 (ggtc) (ggtc) D101C07 (ggtc) (ggtc) (ggtc) E326F07 (ggtc)
D052D03 (ggtc) (ggtc) D155E04 (ggtc) (ggtc) (ggtc) D064H01 (ggtc)
5SE311C07 (ggtc) (ggtc) (ggtc) E121D06 (ggtc) (ggtc)
D153B05 (ggtc) (ggtc) (ggtc) (cmhd) CMHD-GT_260D11-3 (cmhd) (cmhd)
IST11153F4 (tigm) IST10908D9 (tigm) IST12145G12 (tigm) IST12312A7 (tigm)
IST10815G9 (tigm) IST11423A7 (tigm) IST15099F12 (tigm) IST12040H7 (tigm)
IST14641A2 (tigm) IST11568B8 (tigm) IST11316D6 (tigm) IST14479F7 (tigm)
IST14332E11 (tigm) IST12122A10 (tigm) IST14945F12 (tigm) IST11316D6 (tigm)
IST13069C10 (tigm) IST10669E12 (tigm) IST14584G1 (tigm) IST14100F1 (tigm)
IST12596C10 (tigm) IST13638H5 (tigm) IST14111D8 (tigm) IST13053G2 (tigm)
IST11153F4 (tigm) IST13035G7 (tigm) IST14917H7 (tigm) IST11907A6 (tigm)
IST14351A3 (tigm) IST11584A11 (tigm) IST11755D11 (tigm) IST11440D12 (tigm)
IST12667D7 (tigm) IST13055H7 (tigm) IST14374H8 (tigm) IST10810C7 (tigm)
IST10810C7 (tigm) IST10170A12 (tigm) IST10484C11 (tigm) IST12972G4 (tigm)
IST11423A7 (tigm) IST15099F12 (tigm) IST12643E7 (tigm) IST14166D7 (tigm)
IST12312G5 (tigm) IST11988A3 (tigm) IST12667D7 (tigm) IST11907E6 (tigm)
IST11688D10 (tigm) IST15103B3 (tigm) IST12338H1 (tigm) IST11784A1BBF1 (tigm)
IST10853H4 (tigm) IST11440D12 (tigm) IST14981E9 (tigm) IST10097H12 (tigm)
IST14551F10 (tigm) IST14824B1 (tigm) IST12122A10 (tigm) IST11749A1 (tigm)
IST14332A1 (tigm) IST11908B6 (tigm) IST10170A12 (tigm) IST11907D7 (tigm)
IST10157E7 (tigm) IST12312A7 (tigm) IST11749A1 (tigm) IST12972G4 (tigm)
IST10232B7 (tigm)
Private Clones OST428595 (lexicon) OST412392 (lexicon) OST394877 (lexicon) OST389789 (lexicon)
OST389112 (lexicon) OST388529 (lexicon) OST379993 (lexicon) OST378462 (lexicon)
OST377708 (lexicon) OST369719 (lexicon) OST354030 (lexicon) OST345941 (lexicon)
OST327159 (lexicon) OST297635 (lexicon) OST295210 (lexicon) OST293140 (lexicon)
OST288146 (lexicon) OST285137 (lexicon) OST285127 (lexicon) OST279924 (lexicon)
OST270262 (lexicon) OST219539 (lexicon) OST215205 (lexicon) OST192834 (lexicon)
OST192813 (lexicon) OST185470 (lexicon) OST183499 (lexicon) OST179258 (lexicon)
OST179205 (lexicon) OST175183 (lexicon) OST175170 (lexicon) OST172345 (lexicon)
OST166292 (lexicon) OST165879 (lexicon) OST158792 (lexicon) OST148694 (lexicon)
OST148121 (lexicon) OST147545 (lexicon) OST144940 (lexicon) OST142939 (lexicon)
OST142863 (lexicon) OST129230 (lexicon) OST124458 (lexicon) OST116637 (lexicon)
OST114800 (lexicon) OST108788 (lexicon) OST104256 (lexicon) OST103210 (lexicon)
OST102631 (lexicon) OST100656 (lexicon) OST93110 (lexicon) OST83011 (lexicon)
OST73292 (lexicon) OST67689 (lexicon) OST65829 (lexicon) OST63825 (lexicon)
OST63620 (lexicon) OST61576 (lexicon) OST40175 (lexicon) OST40104 (lexicon)
OST38015 (lexicon) OST36681 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000486749 (Chr11:21139284..21139374 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000486749 (Chr11:21139284..21139374 +)
Downstram Exon
ENSMUSE00000101001 (Chr11:21163202..21163357 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486749 Chr11:21139284..21139374 No primer for this exon

*** Putative Vector Insertion (Chr 11: 21139375 - 21163201) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101001 Chr11:21163202..21163357 No primer for this exon
downstream ENSMUSE00000720987 Chr11:21163202..21163357 No primer for this exon
downstream ENSMUSE00000101029 Chr11:21164633..21164874 No primer for this exon
downstream ENSMUSE00000680799 Chr11:21164669..21164874 No primer for this exon
downstream ENSMUSE00000100994 Chr11:21168788..21168866 No primer for this exon
downstream ENSMUSE00000100993 Chr11:21171707..21171741 No primer for this exon
downstream ENSMUSE00000101000 Chr11:21175001..21175132 No primer for this exon
downstream ENSMUSE00000101031 Chr11:21177678..21178063 No primer for this exon
downstream ENSMUSE00000101013 Chr11:21191036..21191162 No primer for this exon
downstream ENSMUSE00000100987 Chr11:21192027..21192134 No primer for this exon
downstream ENSMUSE00000101023 Chr11:21195344..21195399 No primer for this exon
downstream ENSMUSE00000101036 Chr11:21198757..21198853 No primer for this exon
downstream ENSMUSE00000101016 Chr11:21199981..21200321 No primer for this exon
downstream ENSMUSE00000101005 Chr11:21205654..21205783 No primer for this exon
downstream ENSMUSE00000100991 Chr11:21206369..21206550 No primer for this exon
downstream ENSMUSE00000100990 Chr11:21206912..21207024 No primer for this exon
downstream ENSMUSE00000100995 Chr11:21208742..21208805 No primer for this exon
downstream ENSMUSE00000100996 Chr11:21211080..21211185 No primer for this exon
downstream ENSMUSE00000100989 Chr11:21212243..21212330 No primer for this exon
downstream ENSMUSE00000461465 Chr11:21212854..21212975 No primer for this exon
downstream ENSMUSE00000101022 Chr11:21213087..21213167 No primer for this exon
downstream ENSMUSE00000101017 Chr11:21214922..21215029 No primer for this exon
downstream ENSMUSE00000101020 Chr11:21216795..21216889 No primer for this exon
downstream ENSMUSE00000383441 Chr11:21219756..21221136 No primer for this exon
downstream ENSMUSE00000655282 Chr11:21219756..21221125 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:21148425..21148445 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTATTGCGTGACTGGGAAAA Chr11:21154420..21154440 59.16 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020128