Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18169
Trapped Gene
Cspg5 (ENSMUSG00000032482)
Vector Insertion
Chr 9: 110153652 - 110158648
Public Clones not available
Private Clones OST428551 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220020 (Chr9:110153463..110153651 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTCGTGCTTCTCCTCCTG Chr9:110153558..110153577 60.28 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220020 (Chr9:110153463..110153651 +)
Downstram Exon
ENSMUSE00000220019 (Chr9:110158649..110158805 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTCGTGCTTCTCCTCCTG Chr9:110153558..110153577 60.28 60 GTTGTCGTTGTGGAGCTCAG Chr9:110158688..110158707 59.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583196 Chr9:110146287..110148198 GACCTCTCTCTCCACGTTGC Chr9:110147162..110147181 59.99 60
upstream ENSMUSE00000362304 Chr9:110148799..110149894 CACCCTGATACCGAAGGAGA Chr9:110149416..110149435 60.06 55
upstream ENSMUSE00000220020 Chr9:110153463..110153651 CTCTCGTGCTTCTCCTCCTG Chr9:110153558..110153577 60.28 60

*** Putative Vector Insertion (Chr 9: 110153652 - 110158648) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220019 Chr9:110158649..110158805 GTTGTCGTTGTGGAGCTCAG Chr9:110158688..110158707 59.47 55
downstream ENSMUSE00000310179 Chr9:110164564..110165079 CAGACAGTTCACCCCCAAGT Chr9:110164710..110164729 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCGGAGGACCAAGTAAGT Chr9:110153639..110153659 59.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCGGAGGACCAAGTAAGT Chr9:110153639..110153659 59.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032482