Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18185
Trapped Gene
Mthfs (ENSMUSG00000066442)
Vector Insertion
Chr 9: 89109320 - 89110046
Public Clones not available
Private Clones OST428142 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709668 (Chr9:89109250..89109319 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGACAGAAAAGCAGTGGAC Chr9:89109264..89109283 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709668 (Chr9:89109250..89109319 +)
Downstram Exon
ENSMUSE00000531202 (Chr9:89110047..89110308 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGACAGAAAAGCAGTGGAC Chr9:89109264..89109283 59.7 55 TACCGAGGGATGAAGCAGAT Chr9:89110180..89110199 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712332 Chr9:89105995..89106149 TCACGGTAAACAGTGCCAAG Chr9:89106043..89106062 59.76 50
upstream ENSMUSE00000694260 Chr9:89106033..89106149 TCACGGTAAACAGTGCCAAG Chr9:89106043..89106062 59.76 50
upstream ENSMUSE00000718415 Chr9:89106221..89106319 CTGGTCCTGGAGCTTGTGAG Chr9:89106276..89106295 61 60
upstream ENSMUSE00000721025 Chr9:89106222..89106319 CTGGTCCTGGAGCTTGTGAG Chr9:89106276..89106295 61 60
upstream ENSMUSE00000709668 Chr9:89109250..89109319 GGGACAGAAAAGCAGTGGAC Chr9:89109264..89109283 59.7 55

*** Putative Vector Insertion (Chr 9: 89109320 - 89110046) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000531202 Chr9:89110047..89110308 TACCGAGGGATGAAGCAGAT Chr9:89110180..89110199 59.65 50
downstream ENSMUSE00000712983 Chr9:89121009..89121296 AGATTGTGGACGAAGGCACT Chr9:89121142..89121161 59.73 50
downstream ENSMUSE00000713261 Chr9:89121009..89122113 TGGGCTTGGAGAAAGGTATG Chr9:89121085..89121104 60.07 50
downstream ENSMUSE00000694257 Chr9:89134680..89135059 ACACAGCGCTTCAGGTAGGT Chr9:89134785..89134804 59.94 55
downstream ENSMUSE00000708199 Chr9:89134680..89134953 ACACAGCGCTTCAGGTAGGT Chr9:89134785..89134804 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGATGATAATCGCCTTGC Chr9:89109362..89109383 59.69 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACAACTTAGCTCCCACTG Chr9:89109342..89109363 59.55 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066442