Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18191
Trapped Gene
Reep3 (ENSMUSG00000019873)
Vector Insertion
Chr 10: 66476535 - 66477649
Public Clones not available
Private Clones OST427951 (lexicon) OST292610 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098747 (Chr10:66477650..66477795 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098747 (Chr10:66477650..66477795 -)
Downstram Exon
ENSMUSE00000575834 (Chr10:66476432..66476534 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575839 Chr10:66559538..66559655 No primer for this exon
upstream ENSMUSE00000575838 Chr10:66525747..66525819 No primer for this exon
upstream ENSMUSE00000289962 Chr10:66502249..66502325 No primer for this exon
upstream ENSMUSE00000367558 Chr10:66498633..66498753 No primer for this exon
upstream ENSMUSE00000575837 Chr10:66497347..66497460 No primer for this exon
upstream ENSMUSE00000098748 Chr10:66484497..66484641 No primer for this exon
upstream ENSMUSE00000098747 Chr10:66477650..66477795 No primer for this exon

*** Putative Vector Insertion (Chr 10: 66476535 - 66477649) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000575834 Chr10:66476432..66476534 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCAGTGTGCACTGGGTAA Chr10:66477629..66477649 59.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCAGTGTGCACTGGGTAA Chr10:66477629..66477649 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019873