Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18197
Trapped Gene
Agpat5 (ENSMUSG00000031467)
Vector Insertion
Chr 8: 18869009 - 18870837
Public Clones not available
Private Clones OST427706 (lexicon) OST62319 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209756 (Chr8:18868893..18869008 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAATGGCTTCCGCTGTATG Chr8:18868972..18868991 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209756 (Chr8:18868893..18869008 +)
Downstram Exon
ENSMUSE00000209754 (Chr8:18870838..18870927 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAATGGCTTCCGCTGTATG Chr8:18868972..18868991 60.1 45 TGTTCCTGCGTTCACATAGC Chr8:18870927..18870946 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225997 Chr8:18846537..18846778 GACCGGCTTTACTGCGTCTA Chr8:18846713..18846732 60.41 55
upstream ENSMUSE00000209760 Chr8:18861477..18861546 AGCGAATCATCAAAGCACAG Chr8:18861527..18861546 59.03 45
upstream ENSMUSE00000209756 Chr8:18868893..18869008 AAAATGGCTTCCGCTGTATG Chr8:18868972..18868991 60.1 45

*** Putative Vector Insertion (Chr 8: 18869009 - 18870837) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209754 Chr8:18870838..18870927 TGTTCCTGCGTTCACATAGC Chr8:18870927..18870946 59.87 50
downstream ENSMUSE00000209766 Chr8:18876040..18876130 AATGCCTGACTGGCTGAAAG Chr8:18876119..18876138 60.4 50
downstream ENSMUSE00000209767 Chr8:18878007..18878168 GCAACGTGAGTGGCCTTTAT Chr8:18878064..18878083 60.14 50
downstream ENSMUSE00000209762 Chr8:18879605..18879728 AAGTTTTGGGCACTGTTTGC Chr8:18879636..18879655 60.15 45
downstream ENSMUSE00000209758 Chr8:18881738..18881972 GGGTTCCATACAACCAGGTG Chr8:18881931..18881950 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTAAAATGGCTTCCGCTGT Chr8:18868970..18868990 59.23 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTAAAATGGCTTCCGCTGT Chr8:18868970..18868990 59.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031467