Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18214
Trapped Gene
Apc (ENSMUSG00000005871)
Vector Insertion
Chr 18: 34380931 - 34420658
Public Clones (sanger) (sanger) E055B10 (ggtc) E125A02 (ggtc) IST14648A5 (tigm)
IST11644C12 (tigm) IST14540B9 (tigm) IST11272F11 (tigm) IST14962H11 (tigm)
IST14264D9 (tigm) IST14648A4 (tigm)
Private Clones OST427365 (lexicon) OST427118 (lexicon) OST426730 (lexicon) OST382068 (lexicon)
OST360255 (lexicon) OST301926 (lexicon) OST291741 (lexicon) OST166517 (lexicon)
OST166477 (lexicon) OST52435 (lexicon) OST33788 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704166 (Chr18:34380638..34380930 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704166 (Chr18:34380638..34380930 +)
Downstram Exon
ENSMUSE00000435150 (Chr18:34420659..34420811 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704166 Chr18:34380638..34380930 No primer for this exon
upstream ENSMUSE00000511275 Chr18:34380647..34380930 No primer for this exon

*** Putative Vector Insertion (Chr 18: 34380931 - 34420658) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435150 Chr18:34420659..34420811 No primer for this exon
downstream ENSMUSE00000141540 Chr18:34427952..34428033 No primer for this exon
downstream ENSMUSE00000141550 Chr18:34428710..34428908 No primer for this exon
downstream ENSMUSE00000141538 Chr18:34432093..34432201 No primer for this exon
downstream ENSMUSE00000141552 Chr18:34436218..34436331 No primer for this exon
downstream ENSMUSE00000141551 Chr18:34438923..34439006 No primer for this exon
downstream ENSMUSE00000704149 Chr18:34449010..34449012 No primer for this exon
downstream ENSMUSE00000141546 Chr18:34449492..34449596 No primer for this exon
downstream ENSMUSE00000435118 Chr18:34449698..34449844 No primer for this exon
downstream ENSMUSE00000141530 Chr18:34455685..34455783 No primer for this exon
downstream ENSMUSE00000141534 Chr18:34458077..34458455 No primer for this exon
downstream ENSMUSE00000141542 Chr18:34459620..34459715 No primer for this exon
downstream ENSMUSE00000141532 Chr18:34464237..34464376 No primer for this exon
downstream ENSMUSE00000141536 Chr18:34465220..34465297 No primer for this exon
downstream ENSMUSE00000141548 Chr18:34465917..34466033 No primer for this exon
downstream ENSMUSE00000141549 Chr18:34470347..34470561 No primer for this exon
downstream ENSMUSE00000363587 Chr18:34471659..34479735 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCAGACAGGGAATTCAA Chr18:34419901..34419921 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTTCCTGACTCTTTCTTG Chr18:34419882..34419903 60.37 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005871