Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1822
Trapped Gene
Carhsp1 (ENSMUSG00000008393)
Vector Insertion
Chr 16: 8661197 - 8663679
Public Clones BA0063 (sanger) BC0465 (sanger) RRR497 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000563877 (Chr16:8663680..8663802 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000563877 (Chr16:8663680..8663802 -)
Downstram Exon
ENSMUSE00000129742 (Chr16:8660790..8661196 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409484 Chr16:8672206..8672248 No primer for this exon
upstream ENSMUSE00000129745 Chr16:8664348..8664515 No primer for this exon
upstream ENSMUSE00000563877 Chr16:8663680..8663802 No primer for this exon

*** Putative Vector Insertion (Chr 16: 8661197 - 8663679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000129742 Chr16:8660790..8661196 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGATGGTGGTCCTGACATCT Chr16:8663694..8663715 59.98 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGATGGTGGTCCTGACATCT Chr16:8663694..8663715 59.98 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008393