Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18231
Trapped Gene
Tmem170 (ENSMUSG00000031953)
Vector Insertion
Chr 8: 114393659 - 114400402
Public Clones IST10108H4 (tigm) IST10108H4 (tigm) IST14659H9 (tigm) IST10916H10 (tigm)
IST10916H10 (tigm) IST11122F11 (tigm) IST10467D3 (tigm) IST11122F11 (tigm)
IST14554E3 (tigm)
Private Clones OST427121 (lexicon) OST379407 (lexicon) OST334727 (lexicon) OST97689 (lexicon)
OST84027 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368043 (Chr8:114400403..114400575 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTCCACTTCGCTCTGCTC Chr8:114400411..114400430 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368043 (Chr8:114400403..114400575 -)
Downstram Exon
ENSMUSE00000306804 (Chr8:114393488..114393658 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTCCACTTCGCTCTGCTC Chr8:114400411..114400430 59.75 55 AGTAATTGGTCCCACGATGC Chr8:114393482..114393501 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368043 Chr8:114400403..114400575 AACTCCACTTCGCTCTGCTC Chr8:114400411..114400430 59.75 55

*** Putative Vector Insertion (Chr 8: 114393659 - 114400402) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306804 Chr8:114393488..114393658 AGTAATTGGTCCCACGATGC Chr8:114393482..114393501 59.82 50
downstream ENSMUSE00000214928 Chr8:114388798..114390396 CCCGAATGTCCAAAGAGTGT Chr8:114389330..114389349 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACTCCACTTCGCTCTGCT Chr8:114394410..114394430 60.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTTCGCTCTGCTCCTTCC Chr8:114397404..114397424 62.55 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTGAATGTGTGGGTGTTTG Chr8:114397585..114397605 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTGAATGTGTGGGTGTTTG Chr8:114397585..114397605 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031953