Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18266
Trapped Gene
2700094K13Rik (ENSMUSG00000076437)
Vector Insertion
Chr 2: 84510548 - 84510639
Public Clones not available
Private Clones OST426718 (lexicon) OST403998 (lexicon) OST236641 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662179 (Chr2:84510640..84510852 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662179 (Chr2:84510640..84510852 -)
Downstram Exon
ENSMUSE00000662182 (Chr2:84510402..84510547 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662179 Chr2:84510640..84510852 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000662183 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000708438 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55

*** Putative Vector Insertion (Chr 2: 84510548 - 84510639) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662182 Chr2:84510402..84510547 No primer for this exon
downstream ENSMUSE00000718550 Chr2:84510169..84510273 GGAGGGCCCTTCTTAATACC Chr2:84510215..84510234 58.91 55
downstream ENSMUSE00000662181 Chr2:84510144..84510273 GGAGGGCCCTTCTTAATACC Chr2:84510215..84510234 58.91 55
downstream ENSMUSE00000662178 Chr2:84509981..84510273 CACGATGCAAACCTCAACAT Chr2:84510110..84510129 59.57 45
downstream ENSMUSE00000662180 Chr2:84509382..84509554 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50
downstream ENSMUSE00000721448 Chr2:84509375..84509554 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCGTGGTCATTGAGCATT Chr2:84510639..84510659 60.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCGTGGTCATTGAGCATT Chr2:84510639..84510659 60.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000076437