Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18280
Trapped Gene
L3mbtl (ENSMUSG00000035576)
Vector Insertion
Chr 2: 162774624 - 162775193
Public Clones not available
Private Clones OST426541 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000366279 (Chr2:162774506..162774623 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCCTGAAACCCATGAAAA Chr2:162774548..162774567 60.05 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000366279 (Chr2:162774506..162774623 +)
Downstram Exon
ENSMUSE00000412115 (Chr2:162775194..162775275 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCCTGAAACCCATGAAAA Chr2:162774548..162774567 60.05 45 CTCTCGCTCTGCGTCTTTTC Chr2:162775229..162775248 60.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680301 Chr2:162769201..162769276 No primer for this exon
upstream ENSMUSE00000680300 Chr2:162770164..162770329 GATGTTGAAATGCTGGCGTA Chr2:162770233..162770252 59.69 45
upstream ENSMUSE00000429754 Chr2:162772915..162773060 GCCTACAACCGCCTTCATTA Chr2:162773035..162773054 60.1 50
upstream ENSMUSE00000429745 Chr2:162773416..162773630 AATGCAGCTACGCTTGGTCT Chr2:162773418..162773437 60.04 50
upstream ENSMUSE00000363812 Chr2:162773894..162774008 TAAATGAGTACGCGCCACTG Chr2:162773901..162773920 59.9 50
upstream ENSMUSE00000408488 Chr2:162774217..162774364 AGATGCGAGTTCCTGCAAGT Chr2:162774263..162774282 60.02 50
upstream ENSMUSE00000366279 Chr2:162774506..162774623 GCTCCTGAAACCCATGAAAA Chr2:162774548..162774567 60.05 45

*** Putative Vector Insertion (Chr 2: 162774624 - 162775193) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412115 Chr2:162775194..162775275 CTCTCGCTCTGCGTCTTTTC Chr2:162775229..162775248 60.42 55
downstream ENSMUSE00000393800 Chr2:162785252..162785340 CAGCCGTCCTTCTTCTCACT Chr2:162785279..162785298 59.6 55
downstream ENSMUSE00000222757 Chr2:162785817..162785921 TCAATGCCTTCCAGCTTCAT Chr2:162785881..162785900 60.74 45
downstream ENSMUSE00000360173 Chr2:162786683..162786818 CAGAAGTCGTGGCACTCAGA Chr2:162786744..162786763 60.18 55
downstream ENSMUSE00000404446 Chr2:162787139..162787230 TCCAGCTGAACTCCTCTTCC Chr2:162787168..162787187 59.53 55
downstream ENSMUSE00000355647 Chr2:162790163..162790314 TCGTAAGTATCGCCCCAGTC Chr2:162790311..162790330 60.1 55
downstream ENSMUSE00000222722 Chr2:162790738..162790814 GCCTACTGGGTGGATGTAGG Chr2:162790777..162790796 59.43 60
downstream ENSMUSE00000222715 Chr2:162791505..162791590 AAGCTGTCAGGGTCTGGGTA Chr2:162791529..162791548 59.72 55
downstream ENSMUSE00000222707 Chr2:162791734..162791844 CCGATGATCCTCCACATCTT Chr2:162791841..162791860 59.89 50
downstream ENSMUSE00000551746 Chr2:162792282..162792396 TGTGACTCCAGCCATCAAAG Chr2:162792309..162792328 59.83 50
downstream ENSMUSE00000680296 Chr2:162792282..162792446 TGTGACTCCAGCCATCAAAG Chr2:162792309..162792328 59.83 50
downstream ENSMUSE00000593657 Chr2:162792722..162792821 AGGGGAGACAGAGCTGGACT Chr2:162792753..162792772 60.4 60
downstream ENSMUSE00000222687 Chr2:162792988..162793185 CCTTGGGGACAAATTAGACG Chr2:162793165..162793184 59.42 50
downstream ENSMUSE00000469154 Chr2:162793293..162793342 TGGAATCTTGCGATACTTTGG Chr2:162793328..162793348 60.08 42.86
downstream ENSMUSE00000377393 Chr2:162795898..162796055 GGCAAGGTGGACATGAAGAG Chr2:162795949..162795968 60.66 55
downstream ENSMUSE00000353725 Chr2:162796902..162796964 GGTCTGAACGAAGCCAAAGA Chr2:162796925..162796944 60.38 50
downstream ENSMUSE00000380472 Chr2:162800124..162800258 GGCATCGTCAGTGTTTTTGA Chr2:162800252..162800271 59.7 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000035576