Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18286
Trapped Gene
2310016C08Rik (ENSMUSG00000043421)
Vector Insertion
Chr 6: 29222811 - 29224649
Public Clones IST14816F6 (tigm)
Private Clones OST426429 (lexicon) OST406144 (lexicon) OST388677 (lexicon) OST274691 (lexicon)
OST91348 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000357670 (Chr6:29222734..29222810 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTTACTCCTGCACGACCT Chr6:29222749..29222768 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000357670 (Chr6:29222734..29222810 +)
Downstram Exon
ENSMUSE00000702358 (Chr6:29224650..29225186 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTTACTCCTGCACGACCT Chr6:29222749..29222768 59.87 55 CAGTGGGCTCTCCAGTAAGC Chr6:29224813..29224832 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702360 Chr6:29222488..29222608 TGGACTGCAGTGAATCAACC Chr6:29222488..29222507 59.68 50
upstream ENSMUSE00000357670 Chr6:29222734..29222810 TCCTTACTCCTGCACGACCT Chr6:29222749..29222768 59.87 55

*** Putative Vector Insertion (Chr 6: 29222811 - 29224649) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378612 Chr6:29224650..29225445 CAGTGGGCTCTCCAGTAAGC Chr6:29224813..29224832 60.01 60
downstream ENSMUSE00000702358 Chr6:29224650..29225186 CAGTGGGCTCTCCAGTAAGC Chr6:29224813..29224832 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGACCTGGTGTGACTGTGA Chr6:29222763..29222783 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGACCTGGTGTGACTGTGA Chr6:29222763..29222783 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043421