Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18298
Trapped Gene
Dap3 (ENSMUSG00000068921)
Vector Insertion
Chr 3: 88746751 - 88753789
Public Clones IST14339D2 (tigm) IST10058G5 (tigm)
Private Clones OST426195 (lexicon) OST325988 (lexicon) OST319978 (lexicon) OST291576 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000567043 (Chr3:88753790..88753873 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAGCAGGAGTCCTAGTGT Chr3:88753800..88753819 59.47 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000567043 (Chr3:88753790..88753873 -)
Downstram Exon
ENSMUSE00000567041 (Chr3:88746697..88746750 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAGCAGGAGTCCTAGTGT Chr3:88753800..88753819 59.47 60 TGTCAGCATGGTCTTTGCTC Chr3:88746708..88746727 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000567043 Chr3:88753790..88753873 CGGAGCAGGAGTCCTAGTGT Chr3:88753800..88753819 59.47 60

*** Putative Vector Insertion (Chr 3: 88746751 - 88753789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000567041 Chr3:88746697..88746750 TGTCAGCATGGTCTTTGCTC Chr3:88746708..88746727 59.99 50
downstream ENSMUSE00000567038 Chr3:88740071..88740175 AAACAGTTCTGGGACGCTCA Chr3:88740072..88740091 60.83 50
downstream ENSMUSE00000567036 Chr3:88737487..88737588 TAGTGCTGACCCTCATGCTG Chr3:88737532..88737551 60.01 55
downstream ENSMUSE00000567034 Chr3:88734834..88734942 GACAAGCTTCGCCAAAAGTC Chr3:88734896..88734915 60 50
downstream ENSMUSE00000567033 Chr3:88734398..88734490 AACAGCATGGCAGAGACTGA Chr3:88734422..88734441 59.58 50
downstream ENSMUSE00000567032 Chr3:88733318..88733448 GGAAGCGCTCATTGGTAGTT Chr3:88733304..88733323 59.34 50
downstream ENSMUSE00000567031 Chr3:88732369..88732449 TCAACAACTTCTCCCAGAGGA Chr3:88732351..88732371 59.83 47.62
downstream ENSMUSE00000567030 Chr3:88732131..88732289 CAGGAGGTGAAAGAGCCCTA Chr3:88732175..88732194 59.42 55
downstream ENSMUSE00000567029 Chr3:88730933..88730992 TGGACAAGGGAGAGTTCCTC Chr3:88730942..88730961 59.23 55
downstream ENSMUSE00000567028 Chr3:88730194..88730283 GCTCAAGCTCAACACGATTG Chr3:88730232..88730251 59.6 50
downstream ENSMUSE00000567027 Chr3:88729216..88729333 AGGCTCCAGGGCATTAAATC Chr3:88729288..88729307 60.42 50
downstream ENSMUSE00000567026 Chr3:88727558..88727835 CAGGTCAGGGTGTTCAGCTT Chr3:88727628..88727647 60.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAAGGGGACTGAGCCACAC Chr3:88750768..88750788 59.58 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGGACGTGACTGGGAAA Chr3:88747725..88747745 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTGCTTCACAACTGCAGGAC Chr3:88747859..88747880 61.02 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTGCTTCACAACTGCAGGAC Chr3:88747859..88747880 61.02 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068921