Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18316
Trapped Gene
Ccdc22 (ENSMUSG00000031143)
Vector Insertion
Chr X: 7181464 - 7182369
Public Clones not available
Private Clones OST425780 (lexicon) OST389970 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206839 (ChrX:7182370..7182518 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCGAATCCTCATCCAT ChrX:7182390..7182409 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206839 (ChrX:7182370..7182518 -)
Downstram Exon
ENSMUSE00000206838 (ChrX:7181286..7181463 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCGAATCCTCATCCAT ChrX:7182390..7182409 59.89 50 GCCTCTACGACCAGCTCAGT ChrX:7181382..7181401 59.63 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000206839 ChrX:7182370..7182518 CTGACCGAATCCTCATCCAT ChrX:7182390..7182409 59.89 50

*** Putative Vector Insertion (Chr X: 7181464 - 7182369) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206838 ChrX:7181286..7181463 GCCTCTACGACCAGCTCAGT ChrX:7181382..7181401 59.63 60
downstream ENSMUSE00000206842 ChrX:7177747..7177879 CTGATAGCCAAGCTCCAAGG ChrX:7177825..7177844 59.97 55
downstream ENSMUSE00000206850 ChrX:7176755..7176861 AATGGCCCGAAGGAAAATAG ChrX:7176811..7176830 60.27 45
downstream ENSMUSE00000206844 ChrX:7176560..7176626 GGTAGAACCAACCTGCTGGA ChrX:7176558..7176577 60.11 55
downstream ENSMUSE00000206849 ChrX:7176284..7176462 TCTTCATCTCCTGGGCAATC ChrX:7176296..7176315 60.16 50
downstream ENSMUSE00000206847 ChrX:7174664..7174858 GTGCAGTCTCTGCTGTGGAG ChrX:7174804..7174823 59.76 60
downstream ENSMUSE00000206837 ChrX:7173857..7173919 CTGGTACATCTGCCACCTGA ChrX:7173858..7173877 59.7 55
downstream ENSMUSE00000206852 ChrX:7173620..7173739 AAGGTTGATTCCCAGGGTCT ChrX:7173604..7173623 59.79 50
downstream ENSMUSE00000206836 ChrX:7173029..7173148 No primer for this exon
downstream ENSMUSE00000206846 ChrX:7172831..7172947 TCTTCTGAGGTGGCGGTACT ChrX:7172827..7172846 59.87 55
downstream ENSMUSE00000206841 ChrX:7172612..7172713 AACACTGTGGTGCAGCTCCT ChrX:7172641..7172660 60.93 55
downstream ENSMUSE00000206843 ChrX:7172422..7172529 AGGATGCGCTGAGTATAGGC ChrX:7172446..7172465 59.46 55
downstream ENSMUSE00000206851 ChrX:7172086..7172181 GTCGAGCTTCCCAGAGAGAG ChrX:7172100..7172119 59.28 60
downstream ENSMUSE00000206840 ChrX:7171810..7171869 GCAGGGCAGCTAGGTACTTG ChrX:7171793..7171812 60.04 60
downstream ENSMUSE00000206845 ChrX:7171656..7171730 GCCTGTGTCCTCAATGGTCT ChrX:7171670..7171689 60.12 55
downstream ENSMUSE00000401415 ChrX:7170937..7171293 CTGGGTTTAAGATCCCAGCA ChrX:7171033..7171052 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCATAATCGCCTTGCAG ChrX:7182304..7182324 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACCGAATCCTCATCCATT ChrX:7182387..7182407 60.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031143