Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18324
Trapped Gene
1110067D22Rik (ENSMUSG00000042363)
Vector Insertion
Chr 11: 20730130 - 20730278
Public Clones not available
Private Clones OST425670 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274012 (Chr11:20730279..20730350 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGGTTCTCCAGTTCAAGC Chr11:20730301..20730320 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274012 (Chr11:20730279..20730350 -)
Downstram Exon
ENSMUSE00000274006 (Chr11:20730041..20730129 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGGTTCTCCAGTTCAAGC Chr11:20730301..20730320 60.23 50 TTTCGGGGTTGAGATCTACG Chr11:20730020..20730039 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655304 Chr11:20730977..20731025 No primer for this exon
upstream ENSMUSE00000274012 Chr11:20730279..20730350 TTGGGTTCTCCAGTTCAAGC Chr11:20730301..20730320 60.23 50

*** Putative Vector Insertion (Chr 11: 20730130 - 20730278) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274006 Chr11:20730041..20730129 TTTCGGGGTTGAGATCTACG Chr11:20730020..20730039 60.07 50
downstream ENSMUSE00000274001 Chr11:20729272..20729449 AGGTCAAGCTGATGGCAAAG Chr11:20729408..20729427 60.4 50
downstream ENSMUSE00000408484 Chr11:20723585..20726518 AGCTCCAAAGGCATTGCTTA Chr11:20725226..20725245 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGGGTTCTCCAGTTCAA Chr11:20730301..20730321 60.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTGGGTTCTCCAGTTCAA Chr11:20730301..20730321 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042363