Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18328
Trapped Gene
Ubap2l (ENSMUSG00000042520)
Vector Insertion
Chr 3: 89851822 - 89856311
Public Clones (sanger) E128B04 (ggtc) (ggtc) D003C01 (ggtc) (ggtc)
D039E05 (ggtc) D003C01 (ggtc) (ggtc) D039E05 (ggtc) IST14591H3 (tigm)
Private Clones OST425576 (lexicon) OST200055 (lexicon) OST123526 (lexicon) OST96780 (lexicon)
OST78473 (lexicon) OST58593 (lexicon) OST56226 (lexicon) OST56155 (lexicon)
OST37620 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000705780 (Chr3:89856312..89856377 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000705780 (Chr3:89856312..89856377 -)
Downstram Exon
ENSMUSE00000566787 (Chr3:89851692..89851821 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGCTTGTGCTGTGTCTGGT Chr3:89851679..89851698 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456125 Chr3:89856312..89856394 TGGAGGAGACTGAGGTAAAGTTG Chr3:89856368..89856390 59.8 47.83
upstream ENSMUSE00000705780 Chr3:89856312..89856377 No primer for this exon

*** Putative Vector Insertion (Chr 3: 89851822 - 89856311) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566787 Chr3:89851692..89851821 CTGCTTGTGCTGTGTCTGGT Chr3:89851679..89851698 60.1 55
downstream ENSMUSE00000174539 Chr3:89848776..89848853 GTCCGAAATCATCTGTGCAA Chr3:89848790..89848809 59.65 45
downstream ENSMUSE00000174540 Chr3:89847622..89847732 TCATGCAAAGCAATCACACA Chr3:89847658..89847677 59.83 40
downstream ENSMUSE00000375404 Chr3:89842770..89842938 GTCCCGGTCTCGATTTTCTT Chr3:89842815..89842834 60.44 50
downstream ENSMUSE00000566784 Chr3:89842737..89842938 TAGTCTCTGTCCCGGTCTCG Chr3:89842807..89842826 60.4 60
downstream ENSMUSE00000352090 Chr3:89842292..89842387 ACTCTTGGTGCCATCCAATC Chr3:89842328..89842347 59.93 50
downstream ENSMUSE00000379256 Chr3:89838577..89838622 CCTCCTCGCCTACCAGAACT Chr3:89838579..89838598 60.78 60
downstream ENSMUSE00000338869 Chr3:89837987..89838099 AGTGGCCAGTGTTGTTCCAT Chr3:89837986..89838005 60.43 50
downstream ENSMUSE00000455695 Chr3:89835233..89835292 GGGGATAATTTGACCCCTCA Chr3:89835232..89835251 60.88 50
downstream ENSMUSE00000358880 Chr3:89835218..89835292 GGGGATAATTTGACCCCTCA Chr3:89835232..89835251 60.88 50
downstream ENSMUSE00000399600 Chr3:89832247..89832299 CCAGTCTTCAGTTCCCCACT Chr3:89832234..89832253 59.15 55
downstream ENSMUSE00000371978 Chr3:89830515..89830600 GGCAGAGGCACTGAAGACAC Chr3:89830526..89830545 61.02 60
downstream ENSMUSE00000412533 Chr3:89828985..89829156 TGATATGGCATTCTGCTTCG Chr3:89829002..89829021 59.79 45
downstream ENSMUSE00000306899 Chr3:89827353..89827551 TTGAGCCCATATCCCAAGAG Chr3:89827361..89827380 60.03 50
downstream ENSMUSE00000306891 Chr3:89825161..89825438 TGGCGCTTTGTAAAAGGACT Chr3:89825365..89825384 59.88 45
downstream ENSMUSE00000306882 Chr3:89824819..89824991 ACAGGCTCTGACCCAAACTG Chr3:89824878..89824897 60.3 55
downstream ENSMUSE00000306876 Chr3:89823074..89823263 GAATCGGGCCACTCTGATAA Chr3:89823177..89823196 60.04 50
downstream ENSMUSE00000306868 Chr3:89822336..89822390 CTTCAACAGATTGCGTGGTC Chr3:89822314..89822333 59.29 50
downstream ENSMUSE00000306861 Chr3:89821037..89821211 ATCTCCTCCGTATGGCTCAA Chr3:89821045..89821064 59.65 50
downstream ENSMUSE00000306853 Chr3:89820621..89820693 TGTTGAAGTACGCCCAGAAG Chr3:89820611..89820630 58.92 50
downstream ENSMUSE00000306843 Chr3:89819224..89819419 GAGCTTCGAGTTGAGGCTGT Chr3:89819219..89819238 59.75 55
downstream ENSMUSE00000306834 Chr3:89819052..89819140 GAAGGTTGGGAGGAGCTTTT Chr3:89819098..89819117 59.69 50
downstream ENSMUSE00000306826 Chr3:89816608..89816661 TGGAAATCTTGTCTGGAGCA Chr3:89816589..89816608 59.37 45
downstream ENSMUSE00000356782 Chr3:89814355..89814436 GTGTGGGAAACGGGATACTG Chr3:89814387..89814406 60.23 55
downstream ENSMUSE00000384171 Chr3:89813032..89813249 TGAGTCTGCGTCTGGTTCTG Chr3:89813137..89813156 60.18 55
downstream ENSMUSE00000306814 Chr3:89812178..89812283 GTAGCCGAGGCATTCACACT Chr3:89812203..89812222 60.28 55
downstream ENSMUSE00000566778 Chr3:89810142..89810539 AATTAGCTCTCAGCCGTCCA Chr3:89810466..89810485 59.98 50
downstream ENSMUSE00000306806 Chr3:89807167..89807234 CCCGTGTTACTGGAGGTGAC Chr3:89807185..89807204 60.42 60
downstream ENSMUSE00000366425 Chr3:89806201..89806398 GCAGGAGTACCGGAATGAAA Chr3:89806336..89806355 60.07 50
downstream ENSMUSE00000705778 Chr3:89806201..89806395 GCAGGAGTACCGGAATGAAA Chr3:89806336..89806355 60.07 50
downstream ENSMUSE00000346982 Chr3:89805740..89805790 CGCTGGCAACAGAGAATCAT Chr3:89805734..89805753 61.35 50
downstream ENSMUSE00000455707 Chr3:89804818..89804913 GATGGAGCTGGTCTGGCTAC Chr3:89804856..89804875 59.83 60
downstream ENSMUSE00000705777 Chr3:89804137..89804175 AGCTGGTCATCGACGAGAGT Chr3:89804125..89804144 60.02 55
downstream ENSMUSE00000390574 Chr3:89804064..89804175 AGCTGGTCATCGACGAGAGT Chr3:89804125..89804144 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCAGATTTGGGATTCTCT Chr3:89856301..89856321 60.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTACCCTCCCTTCGTGAC Chr3:89853254..89853274 59.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGAAGCCATTCTGCAAACA Chr3:89856385..89856405 59.85 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGAAGCCATTCTGCAAACA Chr3:89856385..89856405 59.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042520