Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1835
Trapped Gene
Prmt3 (ENSMUSG00000030505)
Vector Insertion
Chr 7: 57082266 - 57084301
Public Clones BB0695 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000328388 (Chr7:57082078..57082265 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGATAGAATTGCCTTCTG Chr7:57082134..57082153 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000328388 (Chr7:57082078..57082265 +)
Downstram Exon
ENSMUSE00000673872 (Chr7:57084302..57084400 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGATAGAATTGCCTTCTG Chr7:57082134..57082153 59.81 50 ACGTGGTGTGGCAGTCTATG Chr7:57084338..57084357 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000705759 Chr7:57033731..57033871 No primer for this exon
upstream ENSMUSE00000199881 Chr7:57033951..57034083 No primer for this exon
upstream ENSMUSE00000199883 Chr7:57035679..57035761 No primer for this exon
upstream ENSMUSE00000199885 Chr7:57036491..57036540 No primer for this exon
upstream ENSMUSE00000328457 Chr7:57037312..57037414 GTGCCTTGGGAAAAAGATGA Chr7:57037351..57037370 60.05 45
upstream ENSMUSE00000328447 Chr7:57041437..57041596 GAAAGCGCATCTGTTGTTGA Chr7:57041496..57041515 59.99 45
upstream ENSMUSE00000328436 Chr7:57042603..57042744 CTTCAGCTCCTATGGGCATT Chr7:57042699..57042718 59.29 50
upstream ENSMUSE00000328427 Chr7:57047343..57047408 CCAAAATCCACACATCTTCAAA Chr7:57047381..57047402 59.84 36.36
upstream ENSMUSE00000328417 Chr7:57053676..57053797 TGTTCTGGATGTTGGGTGTG Chr7:57053678..57053697 60.42 50
upstream ENSMUSE00000328405 Chr7:57061897..57061996 TTCCTGTGGAAAAGGTGGAT Chr7:57061956..57061975 59.38 45
upstream ENSMUSE00000328398 Chr7:57073402..57073480 GTCGATGTTGGATTCTGTCCT Chr7:57073422..57073442 59.01 47.62
upstream ENSMUSE00000328388 Chr7:57082078..57082265 GCCGATAGAATTGCCTTCTG Chr7:57082134..57082153 59.81 50

*** Putative Vector Insertion (Chr 7: 57082266 - 57084301) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673872 Chr7:57084302..57084400 ACGTGGTGTGGCAGTCTATG Chr7:57084338..57084357 59.62 55
downstream ENSMUSE00000328379 Chr7:57084314..57084400 ACGTGGTGTGGCAGTCTATG Chr7:57084338..57084357 59.62 55
downstream ENSMUSE00000328373 Chr7:57103865..57103915 CCTGTTGTGGCAATTCTTCTC Chr7:57103917..57103937 59.73 47.62
downstream ENSMUSE00000328369 Chr7:57104107..57104194 GGGCCAGTAGAGAACACGAC Chr7:57104129..57104148 59.73 60
downstream ENSMUSE00000328365 Chr7:57112737..57112846 CACAATGAGGGAACGAGGAT Chr7:57112804..57112823 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGGTAGGTGTGTGAGCATTG Chr7:57082263..57082285 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGGTAGGTGTGTGAGCATTG Chr7:57082263..57082285 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030505