Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18350
Trapped Gene
Rps25 (ENSMUSG00000009927)
Vector Insertion
Chr 9: 44216167 - 44216768
Public Clones P117F01 (ggtc) PST25471-NR (escells) PST20547-NR (escells) PST18871-NR (escells)
PST20593-NL (escells) PST21360-NR (escells) PST21874-NR (escells) PST19303-NR (escells)
PST25253-NR (escells) PST22667-NR (escells) PST16767-NR (escells) PST24215-NR (escells)
PST20437-NR (escells) PST25975-NR (escells) PST19593-NR (escells) PST19235-NR (escells)
PST25074-NR (escells) PST22206-NR (escells) PST23068-NR (escells) PST19553-NR (escells)
IST14408H4 (tigm)
Private Clones OST425116 (lexicon) OST399158 (lexicon) OST348926 (lexicon) OST333344 (lexicon)
OST267246 (lexicon) OST261209 (lexicon) OST248011 (lexicon) OST232396 (lexicon)
OST208765 (lexicon) OST208734 (lexicon) OST192041 (lexicon) OST180474 (lexicon)
OST175853 (lexicon) OST143735 (lexicon) OST98745 (lexicon) OST46373 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000501535 (Chr9:44216071..44216166 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000501535 (Chr9:44216071..44216166 +)
Downstram Exon
ENSMUSE00000502462 (Chr9:44216769..44216952 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700453 Chr9:44215797..44215840 No primer for this exon
upstream ENSMUSE00000501535 Chr9:44216071..44216166 No primer for this exon

*** Putative Vector Insertion (Chr 9: 44216167 - 44216768) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000502462 Chr9:44216769..44216952 No primer for this exon
downstream ENSMUSE00000496355 Chr9:44218037..44218135 No primer for this exon
downstream ENSMUSE00000700449 Chr9:44218229..44218272 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATCTGTGGGACCTGTCGT Chr9:44216192..44216212 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCTGTGGGACCTGTCGT Chr9:44216192..44216212 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009927