Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1837
Trapped Gene
Zfp619 (ENSMUSG00000068959)
Vector Insertion
Chr 7: 46789546 - 46790108
Public Clones BB0350 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000198732 (Chr7:46789485..46789545 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGTATAAACAGCCTGGGAAA Chr7:46789516..46789537 60.36 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000198732 (Chr7:46789485..46789545 +)
Downstram Exon
ENSMUSE00000493432 (Chr7:46790109..46793403 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGTATAAACAGCCTGGGAAA Chr7:46789516..46789537 60.36 45.46 GTTGAAGGGAACTCGAGCAG Chr7:46791883..46791902 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675249 Chr7:46773136..46773234 AGTGCAGTCGAGATCGGAAG Chr7:46773205..46773224 60.56 55
upstream ENSMUSE00000567566 Chr7:46789163..46789289 TTCACCCAGGAAGAGTGGAC Chr7:46789196..46789215 60.09 55
upstream ENSMUSE00000198732 Chr7:46789485..46789545 CCAGTATAAACAGCCTGGGAAA Chr7:46789516..46789537 60.36 45.46

*** Putative Vector Insertion (Chr 7: 46789546 - 46790108) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493432 Chr7:46790109..46793403 GTTGAAGGGAACTCGAGCAG Chr7:46791883..46791902 59.99 55
downstream ENSMUSE00000675247 Chr7:46790109..46795790 AGTTGAAGGGAACTCGAGCA Chr7:46791884..46791903 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:46789597..46789617 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000068959