Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18378
Trapped Gene
Csnk1e (ENSMUSG00000022433)
Vector Insertion
Chr 15: 79269296 - 79271650
Public Clones (sanger)
Private Clones OST424488 (lexicon) OST401660 (lexicon) OST393301 (lexicon) OST376149 (lexicon)
OST250062 (lexicon) OST235103 (lexicon) OST195551 (lexicon) OST171241 (lexicon)
OST139709 (lexicon) OST137944 (lexicon) OST82760 (lexicon) OST63511 (lexicon)
OST49090 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714596 (Chr15:79271651..79272248 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGCATAGCCTCCCTTTGGA Chr15:79271787..79271806 59.8 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714596 (Chr15:79271651..79272248 -)
Downstram Exon
ENSMUSE00000504943 (Chr15:79269202..79269295 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGCATAGCCTCCCTTTGGA Chr15:79271787..79271806 59.8 50 GGCCCAGGCGATACTTATTT Chr15:79269219..79269238 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711145 Chr15:79272358..79272432 No primer for this exon
upstream ENSMUSE00000713441 Chr15:79272358..79272429 No primer for this exon
upstream ENSMUSE00000714596 Chr15:79271651..79272248 TAGCATAGCCTCCCTTTGGA Chr15:79271787..79271806 59.8 50

*** Putative Vector Insertion (Chr 15: 79269296 - 79271650) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000504943 Chr15:79269202..79269295 GGCCCAGGCGATACTTATTT Chr15:79269219..79269238 60.3 50
downstream ENSMUSE00000709783 Chr15:79269202..79269285 GGCCCAGGCGATACTTATTT Chr15:79269219..79269238 60.3 50
downstream ENSMUSE00000717915 Chr15:79269202..79269289 GGCCCAGGCGATACTTATTT Chr15:79269219..79269238 60.3 50
downstream ENSMUSE00000377323 Chr15:79260485..79260595 CGAGCTTGATGGCTACTTCC Chr15:79260532..79260551 59.98 55
downstream ENSMUSE00000557632 Chr15:79260142..79260290 CTGAACTTCCGGGAACAGAA Chr15:79260154..79260173 60.22 50
downstream ENSMUSE00000557630 Chr15:79256689..79256917 GAAGTTGTCGGGCTTCACAT Chr15:79256830..79256849 60.12 50
downstream ENSMUSE00000557627 Chr15:79255930..79256100 TCGCTAATCCGCTCGTACTT Chr15:79255955..79255974 60 50
downstream ENSMUSE00000476709 Chr15:79255270..79255418 CTGGCGCAGGTAGGAGTAGT Chr15:79255320..79255339 59.52 60
downstream ENSMUSE00000647824 Chr15:79254582..79254685 CGCAAGAGCTTCGTTGTCTC Chr15:79254616..79254635 61.26 55
downstream ENSMUSE00000647823 Chr15:79254368..79254485 TATCTTTGAGGGGGCAGTTG Chr15:79254383..79254402 60.07 50
downstream ENSMUSE00000718337 Chr15:79252911..79254485 CTAGTGACTGGGCGAGAAGG Chr15:79253350..79253369 60.01 60
downstream ENSMUSE00000126510 Chr15:79251248..79251440 CGTCTTTCCCGGTCTACATC Chr15:79251378..79251397 59.55 55
downstream ENSMUSE00000126499 Chr15:79251014..79251153 GTGAGATCGCTCTGGGAGAA Chr15:79251105..79251124 60.5 55
downstream ENSMUSE00000377805 Chr15:79250335..79250398 GTGGTCGCTCTCCTCATTTC Chr15:79250331..79250350 59.81 55
downstream ENSMUSE00000712433 Chr15:79249596..79249617 No primer for this exon
downstream ENSMUSE00000480719 Chr15:79248289..79249617 AAAGCCCCATACAACACTGG Chr15:79249130..79249149 59.85 50
downstream ENSMUSE00000716868 Chr15:79248286..79249617 AAAGCCCCATACAACACTGG Chr15:79249130..79249149 59.85 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr15:79271579..79271599 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGATTCATTGACCAGGGTCTT Chr15:79271662..79271685 61.13 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAGTTGCGTGTGGGAAATA Chr15:79269254..79269274 60.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGTTGAAGCATGGAGTTGC Chr15:79269266..79269286 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022433