Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18388
Trapped Gene
Yaf2 (ENSMUSG00000022634)
Vector Insertion
Chr 15: 93116840 - 93116994
Public Clones not available
Private Clones OST424258 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000129064 (Chr15:93116841..93116993 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTACCCAGTCGAAGAAAG Chr15:93116917..93116936 58.79 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000129064 (Chr15:93116841..93116993 -)
Downstram Exon
ENSMUSE00000679663 (Chr15:93116841..93116993 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTACCCAGTCGAAGAAAG Chr15:93116917..93116936 58.79 55 CTTTCTTCGACTGGGTAGGG Chr15:93116895..93116914 58.79 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000553000 Chr15:93167188..93167341 No primer for this exon
upstream ENSMUSE00000679665 Chr15:93167188..93167366 No primer for this exon
upstream ENSMUSE00000552998 Chr15:93166771..93166896 AAGTGCATGATGTGCGATGT Chr15:93166792..93166811 60.15 45
upstream ENSMUSE00000679664 Chr15:93147970..93148039 AAGCTATTGCGAATGCCTTG Chr15:93148006..93148025 60.36 45
upstream ENSMUSE00000129064 Chr15:93116841..93116993 CCCTACCCAGTCGAAGAAAG Chr15:93116917..93116936 58.79 55
upstream ENSMUSE00000679663 Chr15:93116841..93116993 CCCTACCCAGTCGAAGAAAG Chr15:93116917..93116936 58.79 55

*** Putative Vector Insertion (Chr 15: 93116840 - 93116994) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679661 Chr15:93114712..93116053 TCAACGACAACAGCGCTAAC Chr15:93115071..93115090 60.06 50
downstream ENSMUSE00000552993 Chr15:93114341..93116053 TCAACGACAACAGCGCTAAC Chr15:93115071..93115090 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCCCTTTTCGTCCTATG Chr15:93116997..93117017 58.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022634