Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18407
Trapped Gene
Mpp1 (ENSMUSG00000031402)
Vector Insertion
Chr X: 72357741 - 72358924
Public Clones not available
Private Clones OST423946 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209257 (ChrX:72358925..72359005 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTGGGTCGTAGCCATATT ChrX:72358977..72358996 60.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209257 (ChrX:72358925..72359005 -)
Downstram Exon
ENSMUSE00000209260 (ChrX:72357538..72357740 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTGGGTCGTAGCCATATT ChrX:72358977..72358996 60.96 55 CCCTGATAGCTGCCAAACTC ChrX:72357598..72357617 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000209253 ChrX:72376064..72376288 ACAGAAGCGTAACCGACCTG ChrX:72376066..72376085 60.31 55
upstream ENSMUSE00000698104 ChrX:72376064..72376183 ACAGAAGCGTAACCGACCTG ChrX:72376066..72376085 60.31 55
upstream ENSMUSE00000709625 ChrX:72376064..72376288 ACAGAAGCGTAACCGACCTG ChrX:72376066..72376085 60.31 55
upstream ENSMUSE00000209258 ChrX:72371076..72371219 GCTCGGAGAGTTCGTCTCAT ChrX:72371107..72371126 59.56 55
upstream ENSMUSE00000209250 ChrX:72370710..72370788 GCGGCATGATTCATAGACAA ChrX:72370711..72370730 59.65 45
upstream ENSMUSE00000264608 ChrX:72369235..72369320 CATGTTGGGGATGAGATCCT ChrX:72369293..72369312 59.74 50
upstream ENSMUSE00000264602 ChrX:72366774..72366842 CTAATCAGCAGAGTCGCCTTC ChrX:72366785..72366805 59.23 52.38
upstream ENSMUSE00000654990 ChrX:72363173..72363291 GATCCCCAAAAGGACAACCT ChrX:72363245..72363264 60.17 50
upstream ENSMUSE00000264597 ChrX:72363095..72363291 GATCCCCAAAAGGACAACCT ChrX:72363245..72363264 60.17 50
upstream ENSMUSE00000698103 ChrX:72363095..72363231 GAGGGCTCCTCCAAAGAGTC ChrX:72363131..72363150 60.34 60
upstream ENSMUSE00000209254 ChrX:72361395..72361501 TGAAGCACCAAGTTGCAGTC ChrX:72361449..72361468 60.03 50
upstream ENSMUSE00000209256 ChrX:72359573..72359653 CTCCCTGCATTCAAGAGGAA ChrX:72359590..72359609 60.33 50
upstream ENSMUSE00000209257 ChrX:72358925..72359005 GGGTGGGTCGTAGCCATATT ChrX:72358977..72358996 60.96 55

*** Putative Vector Insertion (Chr X: 72357741 - 72358924) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209260 ChrX:72357538..72357740 CCCTGATAGCTGCCAAACTC ChrX:72357598..72357617 59.84 55
downstream ENSMUSE00000209251 ChrX:72357266..72357340 AGGTGCGATGAACACAATGA ChrX:72357262..72357281 60.12 45
downstream ENSMUSE00000698101 ChrX:72357055..72357340 AGGTGCGATGAACACAATGA ChrX:72357262..72357281 60.12 45
downstream ENSMUSE00000698102 ChrX:72355987..72356182 AACTGCAAGCCTGGTCAAAG ChrX:72356019..72356038 60.43 50
downstream ENSMUSE00000654989 ChrX:72355907..72355973 GAAGCAACCCTTTTGGCTTA ChrX:72355894..72355913 59.34 45
downstream ENSMUSE00000264557 ChrX:72355072..72356182 AGAAGACGCCTTTGTGCATT ChrX:72355465..72355484 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:72358854..72358874 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACAACGTGACTGGGAAAACC ChrX:72358857..72358878 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031402