Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18408
Trapped Gene
4632404H22Rik (ENSMUSG00000036022)
Vector Insertion
Chr X: 50613104 - 50613371
Public Clones not available
Private Clones OST423945 (lexicon) OST177588 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000309457 (ChrX:50613372..50613473 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCCCAACCAGAGGATTT ChrX:50613378..50613397 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000309457 (ChrX:50613372..50613473 -)
Downstram Exon
ENSMUSE00000309446 (ChrX:50613018..50613103 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCCCAACCAGAGGATTT ChrX:50613378..50613397 60.3 50 TGGATTGAGAACAGGACTCG ChrX:50613010..50613029 58.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000309488 ChrX:50622053..50622208 AGTATCCGAATGGCTCAGGA ChrX:50622140..50622159 59.65 50
upstream ENSMUSE00000700757 ChrX:50622053..50622197 AGTATCCGAATGGCTCAGGA ChrX:50622140..50622159 59.65 50
upstream ENSMUSE00000700768 ChrX:50622053..50622975 GCGGGTCATTAGAGCCAATA ChrX:50622888..50622907 60.06 50
upstream ENSMUSE00000710587 ChrX:50622053..50622975 GCGGGTCATTAGAGCCAATA ChrX:50622888..50622907 60.06 50
upstream ENSMUSE00000309481 ChrX:50619218..50619296 GGACCAGTACGGCAATTATGA ChrX:50619232..50619252 59.84 47.62
upstream ENSMUSE00000309473 ChrX:50613867..50613910 AAGGCCTGGATATGATGAACA ChrX:50613886..50613906 59.4 42.86
upstream ENSMUSE00000309465 ChrX:50613723..50613777 TGCAGATAAGCCAGTCATGG ChrX:50613741..50613760 59.82 50
upstream ENSMUSE00000309457 ChrX:50613372..50613473 CTTCCCCAACCAGAGGATTT ChrX:50613378..50613397 60.3 50

*** Putative Vector Insertion (Chr X: 50613104 - 50613371) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000309446 ChrX:50613018..50613103 TGGATTGAGAACAGGACTCG ChrX:50613010..50613029 58.8 50
downstream ENSMUSE00000506756 ChrX:50612134..50612198 ACTGGGCCTAATGCACTTGA ChrX:50612137..50612156 60.66 50
downstream ENSMUSE00000700764 ChrX:50612134..50612195 ACCAAGAACACTGGGCCTAA ChrX:50612128..50612147 59.59 50
downstream ENSMUSE00000309431 ChrX:50607213..50607309 GGGTCTCTTAGGCTGGCTTT ChrX:50607253..50607272 59.85 55
downstream ENSMUSE00000700755 ChrX:50607211..50607309 GGGTCTCTTAGGCTGGCTTT ChrX:50607253..50607272 59.85 55
downstream ENSMUSE00000700754 ChrX:50607069..50607106 No primer for this exon
downstream ENSMUSE00000700762 ChrX:50596923..50598548 TGTACCCCAAGGCACCTAAG ChrX:50598361..50598380 59.99 55
downstream ENSMUSE00000520247 ChrX:50596611..50599467 TGTACCCCAAGGCACCTAAG ChrX:50598361..50598380 59.99 55
downstream ENSMUSE00000700756 ChrX:50596602..50599467 TGTACCCCAAGGCACCTAAG ChrX:50598361..50598380 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA ChrX:50613302..50613322 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000036022