Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18418
Trapped Gene
Dars (ENSMUSG00000026356)
Vector Insertion
Chr 1: 130302046 - 130308924
Public Clones (sanger)
Private Clones OST423771 (lexicon) OST310966 (lexicon) OST208956 (lexicon) OST68880 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539984 (Chr1:130308925..130308971 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACCGACCGTTTGTTCTT Chr1:130308944..130308963 59.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539984 (Chr1:130308925..130308971 -)
Downstram Exon
ENSMUSE00000158353 (Chr1:130301943..130302045 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACCGACCGTTTGTTCTT Chr1:130308944..130308963 59.1 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539985 Chr1:130313729..130313902 GGTATCCACTCCCCAAATCC Chr1:130313804..130313823 60.39 55
upstream ENSMUSE00000158352 Chr1:130311931..130311988 No primer for this exon
upstream ENSMUSE00000158349 Chr1:130310237..130310329 GGTCCGTGCAAGAGTTCATA Chr1:130310252..130310271 58.72 50
upstream ENSMUSE00000539984 Chr1:130308925..130308971 CCTACCGACCGTTTGTTCTT Chr1:130308944..130308963 59.1 50

*** Putative Vector Insertion (Chr 1: 130302046 - 130308924) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158353 Chr1:130301943..130302045 No primer for this exon
downstream ENSMUSE00000158360 Chr1:130287848..130287950 TCAACATCCTGCTGGGTACA Chr1:130287842..130287861 60.11 50
downstream ENSMUSE00000158363 Chr1:130285696..130285776 GTTCAGCCAAGCTGATCACA Chr1:130285730..130285749 59.99 50
downstream ENSMUSE00000158359 Chr1:130283694..130283753 No primer for this exon
downstream ENSMUSE00000158358 Chr1:130275343..130275454 TTCTCGGAAGAGATGGCAGA Chr1:130275373..130275392 61.03 50
downstream ENSMUSE00000158361 Chr1:130272755..130272889 AAACATTGGCTCCTCCTTCA Chr1:130272841..130272860 59.67 45
downstream ENSMUSE00000158348 Chr1:130270514..130270661 TGCACCAAAGTGTCAGCAAT Chr1:130270516..130270535 60.31 45
downstream ENSMUSE00000158362 Chr1:130268717..130268863 CATCGTCCATTTCAACTCCA Chr1:130268708..130268727 59.5 45
downstream ENSMUSE00000158357 Chr1:130266070..130266112 CCAAACGACCCAACAGTTTT Chr1:130266059..130266078 59.87 45
downstream ENSMUSE00000158354 Chr1:130264942..130265022 TGGGTCAGGCATGGTATAGA Chr1:130264929..130264948 58.95 50
downstream ENSMUSE00000158350 Chr1:130263498..130263609 CATGGATTCTTTGTGCTCCA Chr1:130263518..130263537 59.65 45
downstream ENSMUSE00000158356 Chr1:130263275..130263346 CAAAGCGGAAGGAATCAATG Chr1:130263283..130263302 60.58 45
downstream ENSMUSE00000343891 Chr1:130260285..130260902 GTGGCTTTAAGGCGTGAGTC Chr1:130260783..130260802 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCACTGTAATCGCCTTG Chr1:130308862..130308882 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTACCGACCGTTTGTTCTT Chr1:130308942..130308963 59.91 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACCTACCGACCGTTTGTTCTT Chr1:130308942..130308963 59.91 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026356