Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18437
Trapped Gene
Jmy (ENSMUSG00000021690)
Vector Insertion
Chr 13: 94229745 - 94234521
Public Clones not available
Private Clones OST423366 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000470065 (Chr13:94234522..94234672 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATTTGGGCCCTCGAAGAAT Chr13:94234635..94234654 60.76 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000470065 (Chr13:94234522..94234672 -)
Downstram Exon
ENSMUSE00000120042 (Chr13:94229575..94229744 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATTTGGGCCCTCGAAGAAT Chr13:94234635..94234654 60.76 45 GGAGTTTTTCCATTCGCTCA Chr13:94229639..94229658 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464934 Chr13:94268257..94269644 CAGAGACAGAGGAGCGGTTC Chr13:94269089..94269108 60.13 60
upstream ENSMUSE00000120049 Chr13:94242576..94242749 CTTCAGCCATTCCGAGACAT Chr13:94242613..94242632 60.22 50
upstream ENSMUSE00000470065 Chr13:94234522..94234672 TATTTGGGCCCTCGAAGAAT Chr13:94234635..94234654 60.76 45

*** Putative Vector Insertion (Chr 13: 94229745 - 94234521) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000120042 Chr13:94229575..94229744 GGAGTTTTTCCATTCGCTCA Chr13:94229639..94229658 60.19 45
downstream ENSMUSE00000120045 Chr13:94223883..94224048 GATTCCAGCTGATCCAATCG Chr13:94223971..94223990 60.57 50
downstream ENSMUSE00000120040 Chr13:94223343..94223530 ACAGACGCTGCCATCTCTTC Chr13:94223427..94223446 60.56 55
downstream ENSMUSE00000569811 Chr13:94222762..94222848 AAACGCTGCTGGAACTTCTC Chr13:94222783..94222802 59.62 50
downstream ENSMUSE00000569810 Chr13:94212541..94212636 GGCTAACCCAGGCACTTTTT Chr13:94212563..94212582 60.48 50
downstream ENSMUSE00000569803 Chr13:94210970..94211576 AACACGGTTTGGGGTCAATA Chr13:94211227..94211246 60.09 45
downstream ENSMUSE00000569802 Chr13:94209394..94209704 AAGCTACCACGCTTCAAGGA Chr13:94209634..94209653 60.01 50
downstream ENSMUSE00000611885 Chr13:94204165..94205374 TAACCTCCCGTTTGTGCTTC Chr13:94205199..94205218 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATGGGGAAGGTAAGCAT Chr13:94234525..94234545 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTACGTGACTGGGAAAACC Chr13:94234454..94234475 58.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021690