Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18441
Trapped Gene
Rpa1 (ENSMUSG00000000751)
Vector Insertion
Chr 11: 75132034 - 75142174
Public Clones IST10087B3 (tigm)
Private Clones OST423307 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000300014 (Chr11:75142175..75142263 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000300014 (Chr11:75142175..75142263 -)
Downstram Exon
ENSMUSE00000300011 (Chr11:75131914..75132033 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000300027 Chr11:75161728..75161837 No primer for this exon
upstream ENSMUSE00000300025 Chr11:75155646..75155696 No primer for this exon
upstream ENSMUSE00000300021 Chr11:75154530..75154608 No primer for this exon
upstream ENSMUSE00000300017 Chr11:75153792..75153900 No primer for this exon
upstream ENSMUSE00000578412 Chr11:75153215..75153277 No primer for this exon
upstream ENSMUSE00000300014 Chr11:75142175..75142263 No primer for this exon

*** Putative Vector Insertion (Chr 11: 75132034 - 75142174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000300011 Chr11:75131914..75132033 No primer for this exon
downstream ENSMUSE00000650776 Chr11:75129607..75129739 No primer for this exon
downstream ENSMUSE00000650775 Chr11:75128315..75128417 No primer for this exon
downstream ENSMUSE00000650774 Chr11:75126803..75126871 No primer for this exon
downstream ENSMUSE00000650773 Chr11:75126480..75126672 No primer for this exon
downstream ENSMUSE00000650772 Chr11:75126195..75126334 No primer for this exon
downstream ENSMUSE00000650771 Chr11:75125802..75125950 No primer for this exon
downstream ENSMUSE00000650770 Chr11:75123635..75123767 No primer for this exon
downstream ENSMUSE00000650769 Chr11:75120617..75120793 No primer for this exon
downstream ENSMUSE00000650768 Chr11:75119610..75119717 No primer for this exon
downstream ENSMUSE00000650767 Chr11:75116170..75116256 No primer for this exon
downstream ENSMUSE00000587797 Chr11:75113852..75114905 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAACATAATCGCCTTGCAG Chr11:75136109..75136129 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCATCTTTGCCATTTCTGG Chr11:75136184..75136205 60.06 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr11:75136193..75136213 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACTTGTCGTGACTGGGAAAA Chr11:75136199..75136220 59.62 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000751