Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1848
Trapped Gene
Esf1 (ENSMUSG00000045624)
Vector Insertion
Chr 2: 139980678 - 139982790
Public Clones AZ0674 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640650 (Chr2:139982791..139982905 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGGATGTGGCCTTAGAA Chr2:139982851..139982870 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640650 (Chr2:139982791..139982905 -)
Downstram Exon
ENSMUSE00000640649 (Chr2:139980530..139980677 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGGATGTGGCCTTAGAA Chr2:139982851..139982870 60.07 50 CTTCCTGTTAAGCGTCGTGA Chr2:139980599..139980618 59.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640648 Chr2:139996213..139996294 No primer for this exon
upstream ENSMUSE00000682686 Chr2:139993802..139993903 TGAAAAGCCGATTGAAGAGAA Chr2:139993807..139993827 59.95 38.1
upstream ENSMUSE00000444523 Chr2:139993508..139994191 CAAGAGGTTTCGAGCCATGT Chr2:139994027..139994046 60.26 50
upstream ENSMUSE00000557757 Chr2:139993508..139993799 CTTTGCCCAAAGGAAAGCTA Chr2:139993590..139993609 59.47 45
upstream ENSMUSE00000557773 Chr2:139989945..139990318 TTTGTTTCCCGAAGAACCTG Chr2:139989998..139990017 60.08 45
upstream ENSMUSE00000640653 Chr2:139986119..139986232 TGCTGGCTCTGTTCAACTCA Chr2:139986155..139986174 60.74 50
upstream ENSMUSE00000640652 Chr2:139985430..139985530 TGGAAAGGAGAGGATGAAGG Chr2:139985494..139985513 59.21 50
upstream ENSMUSE00000640651 Chr2:139984216..139984368 TGCAGTAGCGGAGTGTGATT Chr2:139984295..139984314 59.47 50
upstream ENSMUSE00000640650 Chr2:139982791..139982905 CCAAGGATGTGGCCTTAGAA Chr2:139982851..139982870 60.07 50

*** Putative Vector Insertion (Chr 2: 139980678 - 139982790) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640649 Chr2:139980530..139980677 CTTCCTGTTAAGCGTCGTGA Chr2:139980599..139980618 59.07 50
downstream ENSMUSE00000338220 Chr2:139974489..139974650 CCCATTTGATTTCCATTTCC Chr2:139974473..139974492 59.07 40
downstream ENSMUSE00000711438 Chr2:139964669..139964790 CCCAAGGGGTCAGTTTATCC Chr2:139964700..139964719 60.55 55
downstream ENSMUSE00000716213 Chr2:139964669..139964790 CCCAAGGGGTCAGTTTATCC Chr2:139964700..139964719 60.55 55
downstream ENSMUSE00000460610 Chr2:139954936..139955023 No primer for this exon
downstream ENSMUSE00000682684 Chr2:139954936..139955023 No primer for this exon
downstream ENSMUSE00000510249 Chr2:139950664..139950740 TGAAGATGCGCTGTCTTTTG Chr2:139950672..139950691 60.13 45
downstream ENSMUSE00000682683 Chr2:139950664..139950740 TGAAGATGCGCTGTCTTTTG Chr2:139950672..139950691 60.13 45
downstream ENSMUSE00000467319 Chr2:139949267..139949413 GGTGCTCCACAATCTTGTCA Chr2:139949313..139949332 59.68 50
downstream ENSMUSE00000682682 Chr2:139949267..139949413 GGTGCTCCACAATCTTGTCA Chr2:139949313..139949332 59.68 50
downstream ENSMUSE00000595799 Chr2:139945617..139946641 GCACCGGGTCTCTCAAATTA Chr2:139946097..139946116 60.07 50
downstream ENSMUSE00000682681 Chr2:139945617..139946641 GCACCGGGTCTCTCAAATTA Chr2:139946097..139946116 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCAATGGGAACATCAAC Chr2:139982790..139982810 61.46 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCAATGGGAACATCAAC Chr2:139982790..139982810 61.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045624