Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18480
Trapped Gene
Tnfrsf10b (ENSMUSG00000022074)
Vector Insertion
Chr 14: 70177623 - 70180310
Public Clones IST12639G9 (tigm) IST12639G9 (tigm)
Private Clones OST422688 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348805 (Chr14:70177528..70177622 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCATTCGTCTCTCTTGG Chr14:70177559..70177578 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348805 (Chr14:70177528..70177622 +)
Downstram Exon
ENSMUSE00000412290 (Chr14:70180311..70180380 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCATTCGTCTCTCTTGG Chr14:70177559..70177578 59.98 50 TTACCGGAACCAGCAACTTC Chr14:70180362..70180381 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263828 Chr14:70167336..70167598 ATAGCTTTGCGTTGCTGCTT Chr14:70167567..70167586 60.18 45
upstream ENSMUSE00000263817 Chr14:70170588..70170684 TAACCCAGCCCATAATCGTC Chr14:70170611..70170630 59.78 50
upstream ENSMUSE00000123392 Chr14:70173184..70173294 TGACTACACCAGCCATTCCA Chr14:70173230..70173249 60.11 50
upstream ENSMUSE00000123395 Chr14:70174893..70175001 AATACGGTGTGTCGATGCAA Chr14:70174928..70174947 59.99 45
upstream ENSMUSE00000123398 Chr14:70175879..70176075 ACTGACGGGGAAGAGGAACT Chr14:70175883..70175902 60.11 55
upstream ENSMUSE00000348805 Chr14:70177528..70177622 TGTGCATTCGTCTCTCTTGG Chr14:70177559..70177578 59.98 50

*** Putative Vector Insertion (Chr 14: 70177623 - 70180310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412290 Chr14:70180311..70180380 TTACCGGAACCAGCAACTTC Chr14:70180362..70180381 60.11 50
downstream ENSMUSE00000371745 Chr14:70182039..70184210 GTGTTTCGGCTTTGACCATT Chr14:70182158..70182177 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCACAACACGGTCAGTCCT Chr14:70177613..70177633 60.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACAACACGGTCAGTCCT Chr14:70177613..70177633 60.48 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022074