Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18482
Trapped Gene
Efna4 (ENSMUSG00000028040)
Vector Insertion
Chr 3: 89138355 - 89138703
Public Clones not available
Private Clones OST422677 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175398 (Chr3:89138704..89138772 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTGTCTGTCTGCTGCAAG Chr3:89138711..89138730 59.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175398 (Chr3:89138704..89138772 -)
Downstram Exon
ENSMUSE00000367062 (Chr3:89137660..89138354 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTGTCTGTCTGCTGCAAG Chr3:89138711..89138730 59.21 55 CTCAGATCCTCCGACTTTGC Chr3:89138048..89138067 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367369 Chr3:89141760..89141950 GCCACCCAATCTACTGGAAC Chr3:89141774..89141793 59.41 55
upstream ENSMUSE00000309999 Chr3:89139099..89139394 TTTCAGCCCTGTTCGATTCT Chr3:89139174..89139193 59.81 45
upstream ENSMUSE00000175398 Chr3:89138704..89138772 AGGTGTCTGTCTGCTGCAAG Chr3:89138711..89138730 59.21 55

*** Putative Vector Insertion (Chr 3: 89138355 - 89138703) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367062 Chr3:89137660..89138354 CTCAGATCCTCCGACTTTGC Chr3:89138048..89138067 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGAGCGGTAAGTGAACCA Chr3:89138690..89138710 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGAGCGGTAAGTGAACCA Chr3:89138690..89138710 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028040