Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18497
Trapped Gene
Bcar3 (ENSMUSG00000028121)
Vector Insertion
Chr 3: 122129673 - 122157970
Public Clones IST14270C8 (tigm) IST11387A10 (tigm) IST12987B8 (tigm) IST12410H12 (tigm)
IST12410H12 (tigm) IST10120A5 (tigm) IST12631E1 (tigm) IST11727G8 (tigm)
IST12227E2 (tigm) IST12229A1 (tigm) IST11567F8 (tigm) IST12849A9 (tigm)
IST12822E9 (tigm)
Private Clones OST422474 (lexicon) OST375670 (lexicon) OST114183 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263252 (Chr3:122129363..122129672 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCATACGGTCCTGTGACAA Chr3:122129551..122129570 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263252 (Chr3:122129363..122129672 +)
Downstram Exon
ENSMUSE00000263246 (Chr3:122157971..122158010 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCATACGGTCCTGTGACAA Chr3:122129551..122129570 59.96 50 TCCAGAGTTGGGTCCAGAAG Chr3:122158003..122158022 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333208 Chr3:122122716..122123101 CTTCTCGGGGGAAGATAAGG Chr3:122122732..122122751 60.03 55
upstream ENSMUSE00000263252 Chr3:122129363..122129672 TCCATACGGTCCTGTGACAA Chr3:122129551..122129570 59.96 50

*** Putative Vector Insertion (Chr 3: 122129673 - 122157970) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263246 Chr3:122157971..122158010 TCCAGAGTTGGGTCCAGAAG Chr3:122158003..122158022 60.23 55
downstream ENSMUSE00000563764 Chr3:122207845..122207973 GTCCATGATGTGCCTCTCCT Chr3:122207874..122207893 60.08 55
downstream ENSMUSE00000176418 Chr3:122211044..122211489 TCCTATTGATGGGCTGGAAG Chr3:122211326..122211345 60.03 50
downstream ENSMUSE00000176433 Chr3:122214137..122214240 CAGGTGACTCTCCGACTGGT Chr3:122214236..122214255 60.31 60
downstream ENSMUSE00000176429 Chr3:122215269..122215921 TCATTGGGTCTGAATGACGA Chr3:122215794..122215813 60.05 45
downstream ENSMUSE00000176427 Chr3:122222181..122222296 CTGCCGTCCATGAGGTAAAG Chr3:122222276..122222295 60.65 55
downstream ENSMUSE00000176423 Chr3:122226087..122226258 CGCCACCTGGATGATCTTAT Chr3:122226189..122226208 59.92 50
downstream ENSMUSE00000263191 Chr3:122227842..122227953 ATGGCTGTCTGCGTGTAGTG Chr3:122227903..122227922 59.93 55
downstream ENSMUSE00000176416 Chr3:122228205..122228417 ACATGTCGGTCCCTTCAAAA Chr3:122228309..122228328 60.35 45
downstream ENSMUSE00000332685 Chr3:122232500..122233098 GGGCTGTTAGGATCTGGTTG Chr3:122232634..122232653 59.55 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGCAACAGCCAATTCAGA Chr3:122147682..122147702 60.38 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGCAACAGCCAATTCAGA Chr3:122147682..122147702 60.38 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028121