Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1850
Trapped Gene
AC137156.3-201 (ENSMUSG00000052414)
Vector Insertion
Chr 15: 102393842 - 102424102
Public Clones AZ0578 (sanger) AN0240 (sanger) AE0314 (sanger) AQ0063 (sanger)
AC0267 (sanger)
Private Clones OST431163 (lexicon) OST348097 (lexicon) OST222364 (lexicon) OST207768 (lexicon)
OST188591 (lexicon) OST166105 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678179 (Chr15:102424103..102424171 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACAGACCGTTTGTGTGCAG Chr15:102424122..102424141 60.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678179 (Chr15:102424103..102424171 -)
Downstram Exon
ENSMUSE00000415854 (Chr15:102393745..102393841 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACAGACCGTTTGTGTGCAG Chr15:102424122..102424141 60.36 55 CTGGGCCAAATTTCAGTGTC Chr15:102393750..102393769 60.49 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678169 Chr15:102455793..102455852 No primer for this exon
upstream ENSMUSE00000678181 Chr15:102455470..102455519 AGGACTGAAGTGTGGGGAGA Chr15:102455477..102455496 59.68 55
upstream ENSMUSE00000678179 Chr15:102424103..102424171 GACAGACCGTTTGTGTGCAG Chr15:102424122..102424141 60.36 55

*** Putative Vector Insertion (Chr 15: 102393842 - 102424102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000415854 Chr15:102393745..102393841 CTGGGCCAAATTTCAGTGTC Chr15:102393750..102393769 60.49 50
downstream ENSMUSE00000415868 Chr15:102387891..102388009 TTCATTGAAGAGCCCCACTT Chr15:102387926..102387945 59.67 45
downstream ENSMUSE00000415850 Chr15:102384215..102384352 AGGGGGCGATGAGTCTACTT Chr15:102384238..102384257 60.1 55
downstream ENSMUSE00000415847 Chr15:102381835..102381992 CCTATTTGCCTGTTGGATGG Chr15:102381813..102381832 60.32 50
downstream ENSMUSE00000415843 Chr15:102378204..102378303 GGCATGGTCTGTCCATTAGC Chr15:102378225..102378244 60.49 55
downstream ENSMUSE00000415840 Chr15:102377585..102377698 TTTGGCTTCTGACGGCATAG Chr15:102377566..102377585 61.29 50
downstream ENSMUSE00000415836 Chr15:102376836..102376988 GTGCTGGATGAGGATCTGGT Chr15:102376844..102376863 60.08 55
downstream ENSMUSE00000415833 Chr15:102371171..102371368 TGCAGCTCTGTTTCGCTCTA Chr15:102371239..102371258 60.03 50
downstream ENSMUSE00000645707 Chr15:102368614..102368722 GAGCCACCTCATTGCGTAGT Chr15:102368667..102368686 60.28 55
downstream ENSMUSE00000678168 Chr15:102367085..102368722 CCAGGTACACGAGACAGCAA Chr15:102367528..102367547 59.9 55
downstream ENSMUSE00000645706 Chr15:102364056..102364869 TTCAGCTGCAGATCGAACAC Chr15:102364741..102364760 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAACATATGCTGGCTTG Chr15:102403127..102403147 59.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAACATATGCTGGCTTG Chr15:102403127..102403147 59.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052414