Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18503
Trapped Gene
Tbc1d22b (ENSMUSG00000042203)
Vector Insertion
Chr 17: 29705645 - 29707531
Public Clones not available
Private Clones OST422305 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000417031 (Chr17:29705337..29705644 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGCAGCCCAAGTCCTAGA Chr17:29705509..29705528 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000417031 (Chr17:29705337..29705644 +)
Downstram Exon
ENSMUSE00000417027 (Chr17:29707532..29707711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGCAGCCCAAGTCCTAGA Chr17:29705509..29705528 60.01 55 TTTTCTCCCGGACTGTCATT Chr17:29707663..29707682 59.53 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000548944 Chr17:29686747..29686939 CAGCAAGCAGTTCTGGAAGA Chr17:29686898..29686917 59.31 50
upstream ENSMUSE00000417039 Chr17:29701377..29701433 GGATCCTCGGCTCACAAAAA Chr17:29701413..29701432 62.41 50
upstream ENSMUSE00000417031 Chr17:29705337..29705644 ACTGCAGCCCAAGTCCTAGA Chr17:29705509..29705528 60.01 55

*** Putative Vector Insertion (Chr 17: 29705645 - 29707531) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000417027 Chr17:29707532..29707711 TTTTCTCCCGGACTGTCATT Chr17:29707663..29707682 59.53 45
downstream ENSMUSE00000417022 Chr17:29708610..29708680 CCAGGTCACTGGTCGAACTT Chr17:29708671..29708690 60.15 55
downstream ENSMUSE00000234820 Chr17:29709915..29710043 GGTGCTCTTCATTCCGAGAG Chr17:29710026..29710045 59.95 55
downstream ENSMUSE00000393319 Chr17:29712101..29712166 TTCGTCCTCGGAATGTCAAT Chr17:29712129..29712148 60.46 45
downstream ENSMUSE00000234776 Chr17:29715774..29715888 ATTCCGAGAGGAAGACGACA Chr17:29715885..29715904 59.8 50
downstream ENSMUSE00000394496 Chr17:29731622..29731728 TGTATTCCGTCCAGCAGCTT Chr17:29731730..29731749 60.8 50
downstream ENSMUSE00000234625 Chr17:29732793..29732868 TGGCTGTGCAAACGTGTAAT Chr17:29732819..29732838 60.18 45
downstream ENSMUSE00000234607 Chr17:29736784..29736911 CTGCAGGTACTCCACCTCGT Chr17:29736833..29736852 60.32 60
downstream ENSMUSE00000234586 Chr17:29737091..29737186 GAGATGGAAGTGCGAGAAGC Chr17:29737126..29737145 60.1 55
downstream ENSMUSE00000472519 Chr17:29741789..29743751 TGCTTCACCCTGGAAATAGG Chr17:29742977..29742996 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACGTGACTGGGAAAACC Chr17:29705692..29705712 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042203