Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18514
Trapped Gene
Npepps (ENSMUSG00000001441)
Vector Insertion
Chr 11: 97093313 - 97096368
Public Clones not available
Private Clones OST422040 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111087 (Chr11:97096369..97096429 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111087 (Chr11:97096369..97096429 -)
Downstram Exon
ENSMUSE00000111088 (Chr11:97093203..97093312 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349657 Chr11:97141515..97141890 No primer for this exon
upstream ENSMUSE00000111089 Chr11:97128909..97128993 No primer for this exon
upstream ENSMUSE00000111086 Chr11:97119588..97119665 No primer for this exon
upstream ENSMUSE00000111092 Chr11:97109516..97109637 No primer for this exon
upstream ENSMUSE00000111097 Chr11:97105742..97105849 No primer for this exon
upstream ENSMUSE00000111084 Chr11:97103917..97104117 No primer for this exon
upstream ENSMUSE00000111101 Chr11:97103265..97103361 No primer for this exon
upstream ENSMUSE00000111091 Chr11:97103118..97103151 No primer for this exon
upstream ENSMUSE00000111093 Chr11:97102243..97102357 No primer for this exon
upstream ENSMUSE00000111085 Chr11:97099408..97099572 No primer for this exon
upstream ENSMUSE00000111100 Chr11:97097379..97097483 No primer for this exon
upstream ENSMUSE00000111087 Chr11:97096369..97096429 No primer for this exon

*** Putative Vector Insertion (Chr 11: 97093313 - 97096368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111088 Chr11:97093203..97093312 No primer for this exon
downstream ENSMUSE00000111098 Chr11:97091144..97091207 No primer for this exon
downstream ENSMUSE00000111096 Chr11:97088043..97088182 No primer for this exon
downstream ENSMUSE00000111102 Chr11:97085973..97086107 No primer for this exon
downstream ENSMUSE00000111090 Chr11:97084265..97084484 No primer for this exon
downstream ENSMUSE00000111095 Chr11:97079822..97079964 No primer for this exon
downstream ENSMUSE00000286948 Chr11:97079105..97079161 No primer for this exon
downstream ENSMUSE00000286943 Chr11:97075085..97075192 No primer for this exon
downstream ENSMUSE00000286938 Chr11:97074346..97074501 No primer for this exon
downstream ENSMUSE00000286930 Chr11:97073594..97073641 No primer for this exon
downstream ENSMUSE00000673874 Chr11:97073594..97073755 No primer for this exon
downstream ENSMUSE00000673873 Chr11:97068222..97068582 No primer for this exon
downstream ENSMUSE00000339063 Chr11:97067176..97068582 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATTTACCTAATCGCCTTGC Chr11:97093305..97093326 59.22 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGAATGCTGCCACAGGT Chr11:97093365..97093385 59.74 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001441