Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18516
Trapped Gene
Mtap4 (ENSMUSG00000032479)
Vector Insertion
Chr 9: 109928728 - 109930182
Public Clones not available
Private Clones OST421953 (lexicon) OST415342 (lexicon) OST345732 (lexicon) OST323486 (lexicon)
OST237411 (lexicon) OST207499 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583222 (Chr9:109928605..109928727 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTGGCCAGAAGATGCAAG Chr9:109928664..109928683 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583222 (Chr9:109928605..109928727 +)
Downstram Exon
ENSMUSE00000583221 (Chr9:109930183..109930296 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTGGCCAGAAGATGCAAG Chr9:109928664..109928683 60.4 50 ATCACGGTGCTCGTTAAAGG Chr9:109930208..109930227 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690141 Chr9:109833962..109834444 CGCCTGACACTAGCATCCTT Chr9:109834002..109834021 60.42 55
upstream ENSMUSE00000583224 Chr9:109881354..109881595 GCAGTCGCAGTGGTACAGAA Chr9:109881354..109881373 60.06 55
upstream ENSMUSE00000583223 Chr9:109902276..109902344 TAGCCAATGGTGATCATGGA Chr9:109902303..109902322 59.88 45
upstream ENSMUSE00000583222 Chr9:109928605..109928727 AACTGGCCAGAAGATGCAAG Chr9:109928664..109928683 60.4 50

*** Putative Vector Insertion (Chr 9: 109928728 - 109930182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583221 Chr9:109930183..109930296 ATCACGGTGCTCGTTAAAGG Chr9:109930208..109930227 60.13 50
downstream ENSMUSE00000583220 Chr9:109934603..109934737 TGAGATACAACAGCCGTGGA Chr9:109934651..109934670 60.26 50
downstream ENSMUSE00000583219 Chr9:109936877..109938010 TTTGGGGGATGTCGTATCAT Chr9:109937256..109937275 60.01 45
downstream ENSMUSE00000583218 Chr9:109939246..109939359 GGCGTTTCCTTCTGCTCTAA Chr9:109939333..109939352 59.59 50
downstream ENSMUSE00000634040 Chr9:109954667..109956026 AAGGTGACCGGAGGTTTCTT Chr9:109954900..109954919 59.97 50
downstream ENSMUSE00000690134 Chr9:109965521..109965627 GCGGGGTAGTGATGTCATTT Chr9:109965589..109965608 59.82 50
downstream ENSMUSE00000583216 Chr9:109966732..109966953 TGTTTTGGCTTTCGATGTTG Chr9:109966785..109966804 59.71 40
downstream ENSMUSE00000583215 Chr9:109969989..109970172 GGGTGGTTTTAGGTCCAGGT Chr9:109970082..109970101 60.09 55
downstream ENSMUSE00000583214 Chr9:109971028..109971087 TTTCCCCTCAGTCTTGATGC Chr9:109971050..109971069 60.19 50
downstream ENSMUSE00000583213 Chr9:109971197..109971489 CTGTAGAGCCGACCTTGGAG Chr9:109971460..109971479 60.01 60
downstream ENSMUSE00000219958 Chr9:109973530..109973643 GTTTCTGTGCACTCGCAATG Chr9:109973632..109973651 60.46 50
downstream ENSMUSE00000583212 Chr9:109975117..109975209 GTCCTTGGAACCACACTTGG Chr9:109975182..109975201 60.4 55
downstream ENSMUSE00000583211 Chr9:109980507..109980588 CCACACTTGGAGGAGACCTT Chr9:109980562..109980581 59.15 55
downstream ENSMUSE00000583210 Chr9:109982285..109982397 AAGTGGCCCACGTTATCAAG Chr9:109982378..109982397 59.99 50
downstream ENSMUSE00000529394 Chr9:109983925..109984114 ATCTGGCTGTCCAAGGTCTG Chr9:109984106..109984125 60.26 55
downstream ENSMUSE00000583202 Chr9:109984239..109986450 GGCTTCAGCCTGCAAACTAC Chr9:109985058..109985077 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTTTTGTTTCCAGCCTCA Chr9:109928683..109928703 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTTTTGTTTCCAGCCTCA Chr9:109928683..109928703 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032479