Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18522
Trapped Gene
Klhl2 (ENSMUSG00000031605)
Vector Insertion
Chr 8: 67358468 - 67373530
Public Clones IST12974B12 (tigm)
Private Clones OST421581 (lexicon) OST396378 (lexicon) OST209753 (lexicon) OST44695 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000582122 (Chr8:67373531..67373716 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAGCCACAATGGAGACG Chr8:67373548..67373567 63.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000582122 (Chr8:67373531..67373716 -)
Downstram Exon
ENSMUSE00000582121 (Chr8:67358342..67358467 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAGCCACAATGGAGACG Chr8:67373548..67373567 63.13 60 TCTGATGACCCTGCTTTGTG Chr8:67358423..67358442 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582122 Chr8:67373531..67373716 GAGGAGCCACAATGGAGACG Chr8:67373548..67373567 63.13 60

*** Putative Vector Insertion (Chr 8: 67358468 - 67373530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000582121 Chr8:67358342..67358467 TCTGATGACCCTGCTTTGTG Chr8:67358423..67358442 59.83 50
downstream ENSMUSE00000582120 Chr8:67346891..67346997 CATGTCTTCTGCCACAATCG Chr8:67346933..67346952 60.26 50
downstream ENSMUSE00000683316 Chr8:67335580..67335701 TGCACGTTCTCCTCTGTGAC Chr8:67335559..67335578 60.03 55
downstream ENSMUSE00000431005 Chr8:67258495..67258657 CCGGATTCCTAAGCAGTTGA Chr8:67258531..67258550 60.21 50
downstream ENSMUSE00000430997 Chr8:67242920..67243029 CGATGCCGAGGTTAAGAAAC Chr8:67242954..67242973 59.71 50
downstream ENSMUSE00000430994 Chr8:67238530..67238646 GCAGAGGTAATCGGACATGC Chr8:67238531..67238550 60.63 55
downstream ENSMUSE00000520206 Chr8:67236889..67237038 TTCATTAACATGCGCTGCTC Chr8:67236910..67236929 59.98 45
downstream ENSMUSE00000465337 Chr8:67233082..67233199 TCGTAGCATTCCACACTTCG Chr8:67233119..67233138 59.86 50
downstream ENSMUSE00000463273 Chr8:67231446..67231643 CTTTCACGGGGTCATAGGAA Chr8:67231529..67231548 59.93 50
downstream ENSMUSE00000461258 Chr8:67230526..67230627 ACACTGCTCCTCCTCGTGTT Chr8:67230524..67230543 59.91 55
downstream ENSMUSE00000491580 Chr8:67228492..67228620 TCCACTCGTTTGCAGTAGCA Chr8:67228509..67228528 60.6 50
downstream ENSMUSE00000492527 Chr8:67227829..67227969 CAACCTGTCTCCAGGCATTT Chr8:67227837..67227856 60.11 50
downstream ENSMUSE00000494791 Chr8:67221752..67221895 CATCATCTCCTCCGACAACA Chr8:67221826..67221845 59.63 50
downstream ENSMUSE00000683313 Chr8:67218660..67219771 GCGACTGTTGCCTAAAGACC Chr8:67219452..67219471 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTGCGGCTTTGAAGAGAT Chr8:67367554..67367574 59.08 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGCGGCTTTGAAGAGAT Chr8:67367554..67367574 59.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGTTCTCTAATCGCCTTGC Chr8:67367654..67367674 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCAGATCTGTGGGACAAGT Chr8:67367746..67367766 60.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031605