Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18540
Trapped Gene
Zmiz1 (ENSMUSG00000007817)
Vector Insertion
Chr 14: 26279043 - 26322140
Public Clones not available
Private Clones OST421061 (lexicon) OST367560 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520785 (Chr14:26278778..26279042 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520785 (Chr14:26278778..26279042 +)
Downstram Exon
ENSMUSE00000512608 (Chr14:26322141..26322245 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520785 Chr14:26278778..26279042 No primer for this exon

*** Putative Vector Insertion (Chr 14: 26279043 - 26322140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000512608 Chr14:26322141..26322245 No primer for this exon
downstream ENSMUSE00000515451 Chr14:26356231..26356310 No primer for this exon
downstream ENSMUSE00000373676 Chr14:26391506..26391614 No primer for this exon
downstream ENSMUSE00000345881 Chr14:26395617..26395730 No primer for this exon
downstream ENSMUSE00000356831 Chr14:26401054..26401159 No primer for this exon
downstream ENSMUSE00000401270 Chr14:26455359..26455503 No primer for this exon
downstream ENSMUSE00000254838 Chr14:26463044..26463158 No primer for this exon
downstream ENSMUSE00000254829 Chr14:26464142..26464359 No primer for this exon
downstream ENSMUSE00000378532 Chr14:26465145..26465343 No primer for this exon
downstream ENSMUSE00000430683 Chr14:26466203..26466493 No primer for this exon
downstream ENSMUSE00000254790 Chr14:26469154..26469336 No primer for this exon
downstream ENSMUSE00000501224 Chr14:26470011..26470091 No primer for this exon
downstream ENSMUSE00000121450 Chr14:26470705..26470879 No primer for this exon
downstream ENSMUSE00000121466 Chr14:26471333..26471474 No primer for this exon
downstream ENSMUSE00000563707 Chr14:26472809..26473019 No primer for this exon
downstream ENSMUSE00000563705 Chr14:26473985..26474090 No primer for this exon
downstream ENSMUSE00000121470 Chr14:26474583..26474743 No primer for this exon
downstream ENSMUSE00000563704 Chr14:26475509..26475576 No primer for this exon
downstream ENSMUSE00000121455 Chr14:26475810..26475878 No primer for this exon
downstream ENSMUSE00000121457 Chr14:26476232..26476476 No primer for this exon
downstream ENSMUSE00000121461 Chr14:26477593..26477759 No primer for this exon
downstream ENSMUSE00000254734 Chr14:26480753..26481007 No primer for this exon
downstream ENSMUSE00000401797 Chr14:26482426..26484193 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCTCTGTGTGTGACCTC Chr14:26285002..26285022 59.44 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCTCTGTGTGTGACCTC Chr14:26285002..26285022 59.44 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007817