Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18555
Trapped Gene
1700123O20Rik (ENSMUSG00000040822)
Vector Insertion
Chr 14: 55305958 - 55308640
Public Clones not available
Private Clones OST420806 (lexicon) OST262789 (lexicon) OST205292 (lexicon) OST141068 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000321612 (Chr14:55305879..55305957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCAAGGGGAAAAGGAAG Chr14:55305938..55305957 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000321612 (Chr14:55305879..55305957 +)
Downstram Exon
ENSMUSE00000397207 (Chr14:55308641..55309569 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCAAGGGGAAAAGGAAG Chr14:55305938..55305957 60.04 50 ACCGATGTGGAAGACGATTC Chr14:55308673..55308692 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000321612 Chr14:55305879..55305957 CTTCCAAGGGGAAAAGGAAG Chr14:55305938..55305957 60.04 50

*** Putative Vector Insertion (Chr 14: 55305958 - 55308640) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397207 Chr14:55308641..55309569 ACCGATGTGGAAGACGATTC Chr14:55308673..55308692 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000040822