Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18566
Trapped Gene
Nthl1 (ENSMUSG00000041429)
Vector Insertion
Chr 17: 24775475 - 24775552
Public Clones not available
Private Clones OST420500 (lexicon) OST413048 (lexicon) OST375795 (lexicon) OST180970 (lexicon)
OST53038 (lexicon) OST53036 (lexicon) OST27469 (lexicon) OST14927 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302632 (Chr17:24775369..24775474 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAGCCAACCGACTGAGGTG Chr17:24775392..24775411 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302632 (Chr17:24775369..24775474 +)
Downstram Exon
ENSMUSE00000302605 (Chr17:24775553..24775782 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAGCCAACCGACTGAGGTG Chr17:24775392..24775411 60.13 55 GTTGACCTCACTCCACAGCA Chr17:24775577..24775596 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302711 Chr17:24769655..24769799 GGCTGCTCGGAGGAGTAGTT Chr17:24769665..24769684 60.92 60
upstream ENSMUSE00000302698 Chr17:24770872..24771110 TGAGACATCCACGGAGAACA Chr17:24770896..24770915 60.25 50
upstream ENSMUSE00000302683 Chr17:24771670..24771840 TGATGACACGCTAGGCAGAC Chr17:24771795..24771814 60.02 55
upstream ENSMUSE00000302657 Chr17:24772533..24772692 CACACTTGGCTATGGCTGTG Chr17:24772648..24772667 60.32 55
upstream ENSMUSE00000302632 Chr17:24775369..24775474 ATAGCCAACCGACTGAGGTG Chr17:24775392..24775411 60.13 55

*** Putative Vector Insertion (Chr 17: 24775475 - 24775552) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302605 Chr17:24775553..24775782 GTTGACCTCACTCCACAGCA Chr17:24775577..24775596 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr17:24775525..24775545 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTGTCCTGCTGTCATCC Chr17:24775507..24775527 60.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041429