Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18568
Trapped Gene
Cacng7 (ENSMUSG00000069806)
Vector Insertion
Chr 7: 3338632 - 3338985
Public Clones not available
Private Clones OST420482 (lexicon) OST347364 (lexicon) OST315512 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677466 (Chr7:3338545..3338631 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACTTGGTGACGGAAAACA Chr7:3338597..3338616 59.58 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677466 (Chr7:3338545..3338631 +)
Downstram Exon
ENSMUSE00000677465 (Chr7:3338986..3339126 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACTTGGTGACGGAAAACA Chr7:3338597..3338616 59.58 45 GAAACGAACGCAAGAATGGT Chr7:3339106..3339125 60.12 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677469 Chr7:3333055..3333136 No primer for this exon
upstream ENSMUSE00000677467 Chr7:3336656..3336880 AGACCACCGAGGTCAAGATG Chr7:3336821..3336840 60.11 55
upstream ENSMUSE00000677466 Chr7:3338545..3338631 CAACTTGGTGACGGAAAACA Chr7:3338597..3338616 59.58 45

*** Putative Vector Insertion (Chr 7: 3338632 - 3338985) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677465 Chr7:3338986..3339126 GAAACGAACGCAAGAATGGT Chr7:3339106..3339125 60.12 45
downstream ENSMUSE00000578335 Chr7:3365536..3365681 GTTCATGACCTCGTCGTTGA Chr7:3365600..3365619 59.68 50
downstream ENSMUSE00000578334 Chr7:3366280..3367810 GAGATGGTCCGGGTACTTGA Chr7:3366516..3366535 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAGAATAATCGCCTTGC Chr7:3338675..3338695 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTGGAGAACGTGACTGG Chr7:3338672..3338692 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069806