Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18574
Trapped Gene
Zbtb26 (ENSMUSG00000050714)
Vector Insertion
Chr 2: 37292520 - 37298575
Public Clones IST14245C4 (tigm) IST13778G5 (tigm) IST14250C9 (tigm) IST13878E10 (tigm)
IST12639D12 (tigm)
Private Clones OST420407 (lexicon) OST314405 (lexicon) OST264569 (lexicon) OST206137 (lexicon)
OST73551 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662612 (Chr2:37298576..37298640 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGTAGATGGCGACCTTCC Chr2:37298586..37298605 59.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662612 (Chr2:37298576..37298640 -)
Downstram Exon
ENSMUSE00000662611 (Chr2:37290538..37292519 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGTAGATGGCGACCTTCC Chr2:37298586..37298605 59.51 55 CCTGCTTGGAGGCTTTGTAG Chr2:37291064..37291083 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662612 Chr2:37298576..37298640 GATGTAGATGGCGACCTTCC Chr2:37298586..37298605 59.51 55
upstream ENSMUSE00000567438 Chr2:37298207..37298641 GTCTAGGCCCCCAGACTTTT Chr2:37298442..37298461 59.58 55

*** Putative Vector Insertion (Chr 2: 37292520 - 37298575) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662611 Chr2:37290538..37292519 CCTGCTTGGAGGCTTTGTAG Chr2:37291064..37291083 60.01 55
downstream ENSMUSE00000452064 Chr2:37287690..37292519 CCTGCTTGGAGGCTTTGTAG Chr2:37291064..37291083 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTGGTTTTGCCAGATGT Chr2:37298599..37298619 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCCGTGACTGGGAAAAC Chr2:37295509..37295529 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCAGATGTAGATGGCGATAA Chr2:37295587..37295608 60.07 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAATGCGTGACTGGGAAAAC Chr2:37295575..37295595 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050714