Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18585
Trapped Gene
Ptpn3 (ENSMUSG00000038764)
Vector Insertion
Chr 4: 57282894 - 57283050
Public Clones not available
Private Clones OST420211 (lexicon) OST390549 (lexicon) OST364607 (lexicon) OST354903 (lexicon)
OST317108 (lexicon) OST297388 (lexicon) OST293003 (lexicon) OST284510 (lexicon)
OST281658 (lexicon) OST276258 (lexicon) OST274448 (lexicon) OST260244 (lexicon)
OST238564 (lexicon) OST215936 (lexicon) OST195025 (lexicon) OST169030 (lexicon)
OST165614 (lexicon) OST132219 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711609 (Chr4:57282895..57283049 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711609 (Chr4:57282895..57283049 -)
Downstram Exon
ENSMUSE00000340476 (Chr4:57282895..57283049 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50 GCAATTCAGAGGTTCGGGTA Chr4:57282950..57282969 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456676 Chr4:57314544..57314709 ACTCCGGGCTCTGTAGGAAT Chr4:57314687..57314706 60.1 55
upstream ENSMUSE00000673870 Chr4:57313153..57313217 No primer for this exon
upstream ENSMUSE00000340476 Chr4:57282895..57283049 TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50
upstream ENSMUSE00000711609 Chr4:57282895..57283049 TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50

*** Putative Vector Insertion (Chr 4: 57282894 - 57283050) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367916 Chr4:57277855..57277962 TTGCAAGCCGAAGTATTCCT Chr4:57277860..57277879 59.85 45
downstream ENSMUSE00000332877 Chr4:57277738..57277780 No primer for this exon
downstream ENSMUSE00000371437 Chr4:57275301..57275379 CTGCAGTGTGTTGGGATCAG Chr4:57275293..57275312 60.31 55
downstream ENSMUSE00000336253 Chr4:57270847..57270891 CTTCCTTCGCAAACATCCAT Chr4:57270825..57270844 60.07 45
downstream ENSMUSE00000326363 Chr4:57267789..57267841 CTGCGTACGAGGCTAGAACC Chr4:57267773..57267792 60.04 60
downstream ENSMUSE00000326354 Chr4:57262780..57262900 ACTGGCTGTCGGCAAGATAG Chr4:57262819..57262838 60.42 55
downstream ENSMUSE00000326345 Chr4:57261530..57261617 TGTAGCAAGATTCGGCTTCC Chr4:57261561..57261580 60.35 50
downstream ENSMUSE00000393711 Chr4:57257847..57257935 AGACGCAATCCCGATCATTA Chr4:57257875..57257894 60.44 45
downstream ENSMUSE00000337925 Chr4:57253658..57253721 TGTTTTTGCCGCTGGTGTAT Chr4:57253637..57253656 61.44 45
downstream ENSMUSE00000673864 Chr4:57252400..57252572 GACGCAGGATTTCCACAAGT Chr4:57252473..57252492 60.12 50
downstream ENSMUSE00000673863 Chr4:57248094..57248228 AGCCGTTCCACTGATAAGGA Chr4:57248120..57248139 59.69 50
downstream ENSMUSE00000673862 Chr4:57245194..57245370 CACATCCTCGGTTTCTGTGA Chr4:57245249..57245268 59.68 50
downstream ENSMUSE00000673861 Chr4:57238586..57238772 GGAGCATTCGAAGATGGAGA Chr4:57238670..57238689 60.3 50
downstream ENSMUSE00000673860 Chr4:57238378..57238455 No primer for this exon
downstream ENSMUSE00000673859 Chr4:57236491..57236547 No primer for this exon
downstream ENSMUSE00000673858 Chr4:57234770..57234926 CACCTGGTCATGAGTGTGCT Chr4:57234815..57234834 59.74 55
downstream ENSMUSE00000673857 Chr4:57231381..57231541 CAACACTGTACCGCTTTCCA Chr4:57231371..57231390 59.76 50
downstream ENSMUSE00000461275 Chr4:57219086..57219176 TCCAAATTCTGAGGCAGCTT Chr4:57219093..57219112 59.96 45
downstream ENSMUSE00000506451 Chr4:57218757..57218818 No primer for this exon
downstream ENSMUSE00000527204 Chr4:57217779..57217925 ATCCCAGACAACTTGCCAAA Chr4:57217808..57217827 60.49 45
downstream ENSMUSE00000527203 Chr4:57210378..57210506 AGCATTTCTCGGGACACGTA Chr4:57210372..57210391 60.66 50
downstream ENSMUSE00000673856 Chr4:57209223..57209368 CCCTCAGGGACCTCACATAC Chr4:57209232..57209251 59.38 60
downstream ENSMUSE00000673855 Chr4:57208574..57208709 AACAGGCAGGTTCCTCTCAA Chr4:57208612..57208631 59.84 50
downstream ENSMUSE00000673854 Chr4:57207157..57207234 GAAGGATCGCTTCACACACA Chr4:57207179..57207198 59.84 50
downstream ENSMUSE00000673852 Chr4:57203713..57207234 AGTCACAGACCGGGTGTTTC Chr4:57204060..57204079 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTATGACCTCCCGGTTACG Chr4:57283014..57283034 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATGACCTCCCGGTTACG Chr4:57283014..57283034 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038764