Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18589
Trapped Gene
Grtp1 (ENSMUSG00000038515)
Vector Insertion
Chr 8: 13192209 - 13200048
Public Clones (sanger) IST14715H5 (tigm) IST14948G8 (tigm) IST14481G5 (tigm)
Private Clones OST420151 (lexicon) OST364077 (lexicon) OST301634 (lexicon) OST278890 (lexicon)
OST124004 (lexicon) OST105554 (lexicon) OST53936 (lexicon) OST48636 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273480 (Chr8:13200049..13200200 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGATCCGTATGGGTTTGA Chr8:13200180..13200199 60.15 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273480 (Chr8:13200049..13200200 -)
Downstram Exon
ENSMUSE00000273469 (Chr8:13192050..13192208 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGATCCGTATGGGTTTGA Chr8:13200180..13200199 60.15 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514028 Chr8:13200481..13200620 GCTGCAGAGGTTGTGAGTCC Chr8:13200551..13200570 61.02 60
upstream ENSMUSE00000273480 Chr8:13200049..13200200 ATCGATCCGTATGGGTTTGA Chr8:13200180..13200199 60.15 45

*** Putative Vector Insertion (Chr 8: 13192209 - 13200048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273469 Chr8:13192050..13192208 No primer for this exon
downstream ENSMUSE00000273458 Chr8:13189623..13189747 CGAAACATCACGTTGTCAGG Chr8:13189689..13189708 60.15 50
downstream ENSMUSE00000273446 Chr8:13188510..13188560 GGAAGACCCAGGTTTCTGTG Chr8:13188512..13188531 59.55 55
downstream ENSMUSE00000273440 Chr8:13186883..13186979 CCAACAAGAGCGTCCAAAAG Chr8:13186875..13186894 60.8 50
downstream ENSMUSE00000273430 Chr8:13179583..13179755 GCCACTGCTGGTAGCTTCAT Chr8:13179649..13179668 60.43 55
downstream ENSMUSE00000273420 Chr8:13179323..13179508 GCATGAATGCGTGACACTCT Chr8:13179303..13179322 59.87 50
downstream ENSMUSE00000685645 Chr8:13175162..13177142 ATGGGACAATGTCGGGATAA Chr8:13175367..13175386 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAACCTTAATCGCCTTGC Chr8:13196985..13197005 60.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGCGGCCATTCAAACAAA Chr8:13197003..13197023 60.46 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGAACATAATTGATGCCTTGG Chr8:13194199..13194220 58.49 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGAACATAATTGATGCCTTGG Chr8:13200199..13200220 58.49 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038515