Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18599
Trapped Gene
Ocrl (ENSMUSG00000001173)
Vector Insertion
Chr X: 45315385 - 45316317
Public Clones not available
Private Clones OST419938 (lexicon) OST327176 (lexicon) OST277609 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701418 (ChrX:45315257..45315384 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701418 (ChrX:45315257..45315384 +)
Downstram Exon
ENSMUSE00000206470 (ChrX:45316318..45316429 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701461 ChrX:45265615..45265868 No primer for this exon
upstream ENSMUSE00000718138 ChrX:45265633..45265868 No primer for this exon
upstream ENSMUSE00000719399 ChrX:45265633..45265868 No primer for this exon
upstream ENSMUSE00000481736 ChrX:45266146..45266225 No primer for this exon
upstream ENSMUSE00000701456 ChrX:45266146..45266225 No primer for this exon
upstream ENSMUSE00000555518 ChrX:45269652..45269731 No primer for this exon
upstream ENSMUSE00000701454 ChrX:45269652..45269731 No primer for this exon
upstream ENSMUSE00000555514 ChrX:45273338..45273376 No primer for this exon
upstream ENSMUSE00000701452 ChrX:45273338..45273376 No primer for this exon
upstream ENSMUSE00000555510 ChrX:45283548..45283658 No primer for this exon
upstream ENSMUSE00000701451 ChrX:45283548..45283658 No primer for this exon
upstream ENSMUSE00000555506 ChrX:45284075..45284161 No primer for this exon
upstream ENSMUSE00000701449 ChrX:45284075..45284161 No primer for this exon
upstream ENSMUSE00000555499 ChrX:45284753..45284873 No primer for this exon
upstream ENSMUSE00000701447 ChrX:45284753..45284873 No primer for this exon
upstream ENSMUSE00000555491 ChrX:45284961..45285122 No primer for this exon
upstream ENSMUSE00000701444 ChrX:45284961..45285122 No primer for this exon
upstream ENSMUSE00000555486 ChrX:45286551..45286652 No primer for this exon
upstream ENSMUSE00000701442 ChrX:45286551..45286652 No primer for this exon
upstream ENSMUSE00000555483 ChrX:45288022..45288136 No primer for this exon
upstream ENSMUSE00000701439 ChrX:45288022..45288136 No primer for this exon
upstream ENSMUSE00000555480 ChrX:45289267..45289383 No primer for this exon
upstream ENSMUSE00000701434 ChrX:45289267..45289383 No primer for this exon
upstream ENSMUSE00000555475 ChrX:45289478..45289665 No primer for this exon
upstream ENSMUSE00000701428 ChrX:45289478..45289665 No primer for this exon
upstream ENSMUSE00000555471 ChrX:45291476..45291587 No primer for this exon
upstream ENSMUSE00000701425 ChrX:45291476..45291587 No primer for this exon
upstream ENSMUSE00000555466 ChrX:45294286..45294395 No primer for this exon
upstream ENSMUSE00000555460 ChrX:45296683..45296818 No primer for this exon
upstream ENSMUSE00000701424 ChrX:45297644..45297790 No primer for this exon
upstream ENSMUSE00000322262 ChrX:45300180..45300290 No primer for this exon
upstream ENSMUSE00000322252 ChrX:45300884..45301049 No primer for this exon
upstream ENSMUSE00000716837 ChrX:45301302..45301537 No primer for this exon
upstream ENSMUSE00000719586 ChrX:45301302..45301537 No primer for this exon
upstream ENSMUSE00000487540 ChrX:45309387..45309410 No primer for this exon
upstream ENSMUSE00000701422 ChrX:45309387..45309410 No primer for this exon
upstream ENSMUSE00000701460 ChrX:45309387..45310269 No primer for this exon
upstream ENSMUSE00000701414 ChrX:45313466..45313746 No primer for this exon
upstream ENSMUSE00000206465 ChrX:45313630..45313746 No primer for this exon
upstream ENSMUSE00000701420 ChrX:45313630..45313746 No primer for this exon
upstream ENSMUSE00000206464 ChrX:45314554..45314638 No primer for this exon
upstream ENSMUSE00000701419 ChrX:45314554..45314638 No primer for this exon
upstream ENSMUSE00000206471 ChrX:45315257..45315384 No primer for this exon
upstream ENSMUSE00000701418 ChrX:45315257..45315384 No primer for this exon

*** Putative Vector Insertion (Chr X: 45315385 - 45316317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206470 ChrX:45316318..45316429 No primer for this exon
downstream ENSMUSE00000701417 ChrX:45316318..45316429 No primer for this exon
downstream ENSMUSE00000346032 ChrX:45316637..45319041 No primer for this exon
downstream ENSMUSE00000701410 ChrX:45316637..45318940 No primer for this exon
downstream ENSMUSE00000701416 ChrX:45316637..45319041 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCTCGGATCTGCAAACAG ChrX:45315366..45315386 60.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCATAGAGCGTGACTGG ChrX:45315425..45315445 60.81 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001173