Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18603
Trapped Gene
Ap3b1 (ENSMUSG00000021686)
Vector Insertion
Chr 13: 95129187 - 95160746
Public Clones (sanger) (ggtc)
Private Clones OST419842 (lexicon) OST319429 (lexicon) OST66880 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000449147 (Chr13:95128940..95129186 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACAGTTTCGCCTACAACG Chr13:95129067..95129086 59.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000449147 (Chr13:95128940..95129186 +)
Downstram Exon
ENSMUSE00000301935 (Chr13:95160747..95160822 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACAGTTTCGCCTACAACG Chr13:95129067..95129086 59.39 50 GCATCTGCTTCAGGTCTTCA Chr13:95160772..95160791 59.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449147 Chr13:95128940..95129186 CAACAGTTTCGCCTACAACG Chr13:95129067..95129086 59.39 50

*** Putative Vector Insertion (Chr 13: 95129187 - 95160746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301935 Chr13:95160747..95160822 GCATCTGCTTCAGGTCTTCA Chr13:95160772..95160791 59.12 50
downstream ENSMUSE00000472126 Chr13:95164674..95164748 GGAAGAGTTCCGAGGCATTT Chr13:95164713..95164732 60.58 50
downstream ENSMUSE00000301919 Chr13:95173293..95173388 TTCAAAGCTCGCTGGAAAGT Chr13:95173390..95173409 60.13 45
downstream ENSMUSE00000301912 Chr13:95173902..95174062 AGGCACGATAATTGGCACTC Chr13:95173976..95173995 60.1 50
downstream ENSMUSE00000301904 Chr13:95178732..95178798 No primer for this exon
downstream ENSMUSE00000301899 Chr13:95187916..95188098 TTCTATCCGGGCACACTTCT Chr13:95187970..95187989 59.69 50
downstream ENSMUSE00000301893 Chr13:95210210..95210368 CGACTTCTTCCTGCTGCTCT Chr13:95210299..95210318 59.89 55
downstream ENSMUSE00000301887 Chr13:95213874..95213971 CTCCGACTTGGGTGAGATGT Chr13:95213927..95213946 60.11 55
downstream ENSMUSE00000301880 Chr13:95215877..95215931 No primer for this exon
downstream ENSMUSE00000301875 Chr13:95216021..95216092 No primer for this exon
downstream ENSMUSE00000301869 Chr13:95218408..95218470 TGGCTTCATTTGCCAAGTTT Chr13:95218444..95218463 60.62 40
downstream ENSMUSE00000301862 Chr13:95220908..95221040 GTGTCGGTGACCTCGCTAAT Chr13:95221002..95221021 60.14 55
downstream ENSMUSE00000301857 Chr13:95225351..95225460 GGCTGCATTTGCAACAATTT Chr13:95225408..95225427 61.01 40
downstream ENSMUSE00000301849 Chr13:95232351..95232527 TCCAATTAGCCAAAGGATGC Chr13:95232392..95232411 60.04 45
downstream ENSMUSE00000301843 Chr13:95241631..95241817 TAAATCGTGTGCGGTCTCTG Chr13:95241712..95241731 59.86 50
downstream ENSMUSE00000120009 Chr13:95242754..95242884 AGGTACCCGGACGCTTTAAT Chr13:95242820..95242839 59.86 50
downstream ENSMUSE00000120013 Chr13:95246921..95247083 CAGAGGGGTTCTCATCCTCA Chr13:95247068..95247087 60.19 55
downstream ENSMUSE00000120019 Chr13:95249682..95249829 CCACTGGACGAGTCCTCACT Chr13:95249751..95249770 60.31 60
downstream ENSMUSE00000120017 Chr13:95253168..95253315 TCCTCACTGGACGATTCAGA Chr13:95253233..95253252 59.34 50
downstream ENSMUSE00000120010 Chr13:95263624..95263696 TGTCTTTCTTGCTGGGGTTT Chr13:95263658..95263677 59.71 45
downstream ENSMUSE00000120011 Chr13:95271873..95271979 CTGGGGTGGATACTGGGTTA Chr13:95271896..95271915 59.67 55
downstream ENSMUSE00000120012 Chr13:95298120..95298351 CACGAAGACAGGCGTACTGA Chr13:95298143..95298162 60.05 55
downstream ENSMUSE00000120016 Chr13:95301937..95302021 TGGCCGTCTGTGTAGAATCA Chr13:95302011..95302030 60.26 50
downstream ENSMUSE00000120014 Chr13:95312734..95312831 TGACGTTGAAGCAGTCATCC Chr13:95312762..95312781 59.84 50
downstream ENSMUSE00000301756 Chr13:95317710..95317848 GTGGAGCAGCGATGAGTGTA Chr13:95317763..95317782 60.02 55
downstream ENSMUSE00000391773 Chr13:95335560..95336264 AACCAATCACGGTTTTCTCG Chr13:95335672..95335691 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTTTGCACACACATTTCAC Chr13:95153153..95153174 59.53 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGTTTGCACACACATTTCAC Chr13:95153153..95153174 59.53 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021686